Incidental Mutation 'R4714:Vps52'
ID353474
Institutional Source Beutler Lab
Gene Symbol Vps52
Ensembl Gene ENSMUSG00000024319
Gene NameVPS52 GARP complex subunit
Synonymstclw5, ARE1, Sacm2l, D430041K17Rik, tcl-w5
MMRRC Submission 041956-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4714 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location33955812-33966984 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33961179 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 354 (I354V)
Ref Sequence ENSEMBL: ENSMUSP00000025178 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025178] [ENSMUST00000173196]
Predicted Effect probably benign
Transcript: ENSMUST00000025178
AA Change: I354V

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000025178
Gene: ENSMUSG00000024319
AA Change: I354V

DomainStartEndE-ValueType
low complexity region 1 11 N/A INTRINSIC
low complexity region 24 45 N/A INTRINSIC
Pfam:Sec3_C 79 244 4.6e-13 PFAM
Pfam:Vps52 94 601 5.1e-233 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122652
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172558
Predicted Effect probably benign
Transcript: ENSMUST00000173196
AA Change: I286V

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000133926
Gene: ENSMUSG00000024319
AA Change: I286V

DomainStartEndE-ValueType
low complexity region 18 39 N/A INTRINSIC
Pfam:Vps52 88 120 2.7e-6 PFAM
Pfam:Vps52 116 527 3e-181 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173318
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173445
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174588
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is similar to the yeast suppressor of actin mutations 2 gene. The yeast protein forms a subunit of the tetrameric Golgi-associated retrograde protein complex that is involved in vesicle trafficking from from both early and late endosomes, back to the trans-Golgi network. This gene is located on chromosome 6 in a head-to-head orientation with the gene encoding ribosomal protein S18. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a null mutation display early embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4930486L24Rik A G 13: 60,844,318 V298A probably damaging Het
Abca12 A G 1: 71,321,450 V534A probably benign Het
Abcb4 A G 5: 8,930,906 probably null Het
Adam30 A T 3: 98,162,854 S668C probably damaging Het
Ap1g1 T A 8: 109,829,620 V196D probably damaging Het
Atp11b G A 3: 35,834,394 V738I probably benign Het
Cast C T 13: 74,798,715 V27I probably damaging Het
Cfap54 A G 10: 92,815,918 I3090T probably benign Het
Cgn C A 3: 94,779,438 G185W probably damaging Het
Champ1 T C 8: 13,878,063 Y74H probably damaging Het
Cpm T C 10: 117,675,985 I278T probably damaging Het
Dcaf15 T C 8: 84,102,216 T141A probably benign Het
Dcun1d1 C T 3: 35,895,670 V244M probably damaging Het
Defb8 A G 8: 19,447,559 L12P probably damaging Het
Dlg1 A T 16: 31,790,261 I225F probably damaging Het
Dync2h1 G T 9: 7,118,932 H2178N possibly damaging Het
Enam A G 5: 88,503,536 E893G probably damaging Het
Flt4 T A 11: 49,627,207 L358Q probably damaging Het
Frmpd1 A G 4: 45,284,785 Q1202R probably benign Het
Ghr T A 15: 3,320,397 D433V possibly damaging Het
Grm7 G A 6: 111,080,422 D328N possibly damaging Het
Haus4 T C 14: 54,542,120 D349G probably benign Het
Helz T C 11: 107,626,716 probably null Het
Hif3a A G 7: 17,056,271 L69P probably damaging Het
Ifit1 A G 19: 34,648,163 E233G probably damaging Het
Kcnc2 T C 10: 112,455,828 F307S possibly damaging Het
Lrp1b A T 2: 41,110,759 V2151E possibly damaging Het
Lrp5 T C 19: 3,659,454 N92S probably damaging Het
Metrnl C T 11: 121,716,013 A216V probably damaging Het
Msh2 A G 17: 87,718,789 T732A probably damaging Het
Necab2 T C 8: 119,467,595 L270P probably damaging Het
Noc3l T C 19: 38,815,713 K74E probably benign Het
Oas2 A T 5: 120,733,472 L702Q probably damaging Het
Olfr136 A C 17: 38,335,840 I228L possibly damaging Het
Olfr3 A T 2: 36,813,035 I19N probably benign Het
Olfr728 A G 14: 50,139,979 I220T possibly damaging Het
Olfr731 C A 14: 50,238,367 V173L possibly damaging Het
Olfr812 A T 10: 129,842,945 N32K probably damaging Het
Pax6 A G 2: 105,695,400 H376R possibly damaging Het
Pnkd C T 1: 74,351,782 R376C probably damaging Het
Pnpla8 T C 12: 44,295,913 F484S probably damaging Het
Psme4 T A 11: 30,832,573 H909Q probably benign Het
Rasip1 CGG CGGG 7: 45,632,396 probably null Het
Rbm47 A T 5: 66,025,052 Y413N probably damaging Het
Rnf123 A G 9: 108,052,439 probably null Het
Ruvbl1 T A 6: 88,484,430 M259K possibly damaging Het
Sohlh2 A G 3: 55,190,529 H134R probably benign Het
Sorbs2 A G 8: 45,795,293 D447G possibly damaging Het
Tank C T 2: 61,650,229 P370S probably benign Het
Tenm4 A G 7: 96,894,924 E2049G probably damaging Het
Tnik A G 3: 28,594,077 H426R possibly damaging Het
Trpm6 C A 19: 18,854,200 S1476R possibly damaging Het
Trpm7 G A 2: 126,840,783 Q389* probably null Het
Ttc28 G A 5: 111,285,229 R2043Q possibly damaging Het
Tymp A G 15: 89,376,307 S103P probably damaging Het
Usp40 C T 1: 87,967,179 probably null Het
Vmn1r202 T A 13: 22,501,807 N147Y probably damaging Het
Vmn2r89 T C 14: 51,452,231 S64P probably damaging Het
Vps13a A T 19: 16,749,856 D229E probably benign Het
Zbtb8os T C 4: 129,341,764 F90L probably damaging Het
Zfp36l1 T C 12: 80,110,496 D37G possibly damaging Het
Zfp467 A G 6: 48,427,817 S109P unknown Het
Zzef1 T A 11: 72,837,212 C535S probably damaging Het
Other mutations in Vps52
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Vps52 APN 17 33956958 missense possibly damaging 0.96
IGL01098:Vps52 APN 17 33962730 missense possibly damaging 0.90
IGL01705:Vps52 APN 17 33966068 missense probably damaging 1.00
IGL01722:Vps52 APN 17 33961615 nonsense probably null
IGL02992:Vps52 APN 17 33958350 missense probably damaging 0.97
IGL03279:Vps52 APN 17 33957874 missense probably damaging 0.96
R0363:Vps52 UTSW 17 33962117 missense probably benign 0.26
R0762:Vps52 UTSW 17 33960011 missense probably damaging 1.00
R1065:Vps52 UTSW 17 33961239 missense probably benign 0.02
R1506:Vps52 UTSW 17 33957894 missense probably damaging 1.00
R3760:Vps52 UTSW 17 33960188 missense possibly damaging 0.64
R5381:Vps52 UTSW 17 33958301 missense possibly damaging 0.77
R5590:Vps52 UTSW 17 33961221 missense probably benign 0.01
R5928:Vps52 UTSW 17 33961126 missense possibly damaging 0.85
R6003:Vps52 UTSW 17 33956094 start codon destroyed probably null 0.01
R6302:Vps52 UTSW 17 33963215 missense probably damaging 1.00
R6574:Vps52 UTSW 17 33962478 missense probably null 0.34
R6695:Vps52 UTSW 17 33963199 nonsense probably null
R6888:Vps52 UTSW 17 33963206 missense probably benign 0.06
R7022:Vps52 UTSW 17 33959319 missense probably benign 0.04
R7136:Vps52 UTSW 17 33965288 missense probably benign 0.00
R7380:Vps52 UTSW 17 33958309 missense possibly damaging 0.82
R7727:Vps52 UTSW 17 33962134 missense probably benign 0.21
R7888:Vps52 UTSW 17 33965751 missense probably damaging 0.98
R7971:Vps52 UTSW 17 33965751 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACCTTGACAGCCATTAAGGG -3'
(R):5'- TCTGAGTCCATGGCTCCTAAC -3'

Sequencing Primer
(F):5'- CTCAGGTTCTGGAAAGGGCTATCC -3'
(R):5'- CTTCCCGCATCACAGCAGG -3'
Posted On2015-10-21