Mutagenetix > Incidental Mutations

Incidental Mutation 'R4714:Vps52'

353474

Institutional Source

Beutler Lab

Gene Symbol

Vps52

Ensembl Gene

ENSMUSG00000024319

Gene Name

VPS52 GARP complex subunit

Synonyms

tclw5, ARE1, Sacm2l, D430041K17Rik, tcl-w5

MMRRC Submission

041956-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4714 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

33955812-33966984 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 33961179 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 354 (I354V)

Ref Sequence

ENSEMBL: ENSMUSP00000025178 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025178] [ENSMUST00000173196]

Predicted Effect

probably benign
Transcript: ENSMUST00000025178
AA Change: I354V

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000025178
Gene: ENSMUSG00000024319
AA Change: I354V

Domain	Start	End	E-Value	Type
low complexity region	1	11	N/A	INTRINSIC
low complexity region	24	45	N/A	INTRINSIC
Pfam:Sec3_C	79	244	4.6e-13	PFAM
Pfam:Vps52	94	601	5.1e-233	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122652

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172558

Predicted Effect

probably benign
Transcript: ENSMUST00000173196
AA Change: I286V

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000133926
Gene: ENSMUSG00000024319
AA Change: I286V

Domain	Start	End	E-Value	Type
low complexity region	18	39	N/A	INTRINSIC
Pfam:Vps52	88	120	2.7e-6	PFAM
Pfam:Vps52	116	527	3e-181	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173318

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173445

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174588

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is similar to the yeast suppressor of actin mutations 2 gene. The yeast protein forms a subunit of the tetrameric Golgi-associated retrograde protein complex that is involved in vesicle trafficking from from both early and late endosomes, back to the trans-Golgi network. This gene is located on chromosome 6 in a head-to-head orientation with the gene encoding ribosomal protein S18. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a null mutation display early embryonic lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	G	T	12: 71,164,546	E685*	probably null	Het
2700049A03Rik	A	T	12: 71,164,547	E685V	possibly damaging	Het
4930486L24Rik	A	G	13: 60,844,318	V298A	probably damaging	Het
Abca12	A	G	1: 71,321,450	V534A	probably benign	Het
Abcb4	A	G	5: 8,930,906		probably null	Het
Adam30	A	T	3: 98,162,854	S668C	probably damaging	Het
Ap1g1	T	A	8: 109,829,620	V196D	probably damaging	Het
Atp11b	G	A	3: 35,834,394	V738I	probably benign	Het
Cast	C	T	13: 74,798,715	V27I	probably damaging	Het
Cfap54	A	G	10: 92,815,918	I3090T	probably benign	Het
Cgn	C	A	3: 94,779,438	G185W	probably damaging	Het
Champ1	T	C	8: 13,878,063	Y74H	probably damaging	Het
Cpm	T	C	10: 117,675,985	I278T	probably damaging	Het
Dcaf15	T	C	8: 84,102,216	T141A	probably benign	Het
Dcun1d1	C	T	3: 35,895,670	V244M	probably damaging	Het
Defb8	A	G	8: 19,447,559	L12P	probably damaging	Het
Dlg1	A	T	16: 31,790,261	I225F	probably damaging	Het
Dync2h1	G	T	9: 7,118,932	H2178N	possibly damaging	Het
Enam	A	G	5: 88,503,536	E893G	probably damaging	Het
Flt4	T	A	11: 49,627,207	L358Q	probably damaging	Het
Frmpd1	A	G	4: 45,284,785	Q1202R	probably benign	Het
Ghr	T	A	15: 3,320,397	D433V	possibly damaging	Het
Grm7	G	A	6: 111,080,422	D328N	possibly damaging	Het
Haus4	T	C	14: 54,542,120	D349G	probably benign	Het
Helz	T	C	11: 107,626,716		probably null	Het
Hif3a	A	G	7: 17,056,271	L69P	probably damaging	Het
Ifit1	A	G	19: 34,648,163	E233G	probably damaging	Het
Kcnc2	T	C	10: 112,455,828	F307S	possibly damaging	Het
Lrp1b	A	T	2: 41,110,759	V2151E	possibly damaging	Het
Lrp5	T	C	19: 3,659,454	N92S	probably damaging	Het
Metrnl	C	T	11: 121,716,013	A216V	probably damaging	Het
Msh2	A	G	17: 87,718,789	T732A	probably damaging	Het
Necab2	T	C	8: 119,467,595	L270P	probably damaging	Het
Noc3l	T	C	19: 38,815,713	K74E	probably benign	Het
Oas2	A	T	5: 120,733,472	L702Q	probably damaging	Het
Olfr136	A	C	17: 38,335,840	I228L	possibly damaging	Het
Olfr3	A	T	2: 36,813,035	I19N	probably benign	Het
Olfr728	A	G	14: 50,139,979	I220T	possibly damaging	Het
Olfr731	C	A	14: 50,238,367	V173L	possibly damaging	Het
Olfr812	A	T	10: 129,842,945	N32K	probably damaging	Het
Pax6	A	G	2: 105,695,400	H376R	possibly damaging	Het
Pnkd	C	T	1: 74,351,782	R376C	probably damaging	Het
Pnpla8	T	C	12: 44,295,913	F484S	probably damaging	Het
Psme4	T	A	11: 30,832,573	H909Q	probably benign	Het
Rasip1	CGG	CGGG	7: 45,632,396		probably null	Het
Rbm47	A	T	5: 66,025,052	Y413N	probably damaging	Het
Rnf123	A	G	9: 108,052,439		probably null	Het
Ruvbl1	T	A	6: 88,484,430	M259K	possibly damaging	Het
Sohlh2	A	G	3: 55,190,529	H134R	probably benign	Het
Sorbs2	A	G	8: 45,795,293	D447G	possibly damaging	Het
Tank	C	T	2: 61,650,229	P370S	probably benign	Het
Tenm4	A	G	7: 96,894,924	E2049G	probably damaging	Het
Tnik	A	G	3: 28,594,077	H426R	possibly damaging	Het
Trpm6	C	A	19: 18,854,200	S1476R	possibly damaging	Het
Trpm7	G	A	2: 126,840,783	Q389*	probably null	Het
Ttc28	G	A	5: 111,285,229	R2043Q	possibly damaging	Het
Tymp	A	G	15: 89,376,307	S103P	probably damaging	Het
Usp40	C	T	1: 87,967,179		probably null	Het
Vmn1r202	T	A	13: 22,501,807	N147Y	probably damaging	Het
Vmn2r89	T	C	14: 51,452,231	S64P	probably damaging	Het
Vps13a	A	T	19: 16,749,856	D229E	probably benign	Het
Zbtb8os	T	C	4: 129,341,764	F90L	probably damaging	Het
Zfp36l1	T	C	12: 80,110,496	D37G	possibly damaging	Het
Zfp467	A	G	6: 48,427,817	S109P	unknown	Het
Zzef1	T	A	11: 72,837,212	C535S	probably damaging	Het

Other mutations in Vps52

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00946:Vps52	APN	17	33956958	missense	possibly damaging	0.96
IGL01098:Vps52	APN	17	33962730	missense	possibly damaging	0.90
IGL01705:Vps52	APN	17	33966068	missense	probably damaging	1.00
IGL01722:Vps52	APN	17	33961615	nonsense	probably null
IGL02992:Vps52	APN	17	33958350	missense	probably damaging	0.97
IGL03279:Vps52	APN	17	33957874	missense	probably damaging	0.96
R0363:Vps52	UTSW	17	33962117	missense	probably benign	0.26
R0762:Vps52	UTSW	17	33960011	missense	probably damaging	1.00
R1065:Vps52	UTSW	17	33961239	missense	probably benign	0.02
R1506:Vps52	UTSW	17	33957894	missense	probably damaging	1.00
R3760:Vps52	UTSW	17	33960188	missense	possibly damaging	0.64
R5381:Vps52	UTSW	17	33958301	missense	possibly damaging	0.77
R5590:Vps52	UTSW	17	33961221	missense	probably benign	0.01
R5928:Vps52	UTSW	17	33961126	missense	possibly damaging	0.85
R6003:Vps52	UTSW	17	33956094	start codon destroyed	probably null	0.01
R6302:Vps52	UTSW	17	33963215	missense	probably damaging	1.00
R6574:Vps52	UTSW	17	33962478	missense	probably null	0.34
R6695:Vps52	UTSW	17	33963199	nonsense	probably null
R6888:Vps52	UTSW	17	33963206	missense	probably benign	0.06
R7022:Vps52	UTSW	17	33959319	missense	probably benign	0.04
R7136:Vps52	UTSW	17	33965288	missense	probably benign	0.00
R7380:Vps52	UTSW	17	33958309	missense	possibly damaging	0.82
R7727:Vps52	UTSW	17	33962134	missense	probably benign	0.21
R7888:Vps52	UTSW	17	33965751	missense	probably damaging	0.98
R7971:Vps52	UTSW	17	33965751	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- ACCTTGACAGCCATTAAGGG -3'
(R):5'- TCTGAGTCCATGGCTCCTAAC -3'

Sequencing Primer
(F):5'- CTCAGGTTCTGGAAAGGGCTATCC -3'
(R):5'- CTTCCCGCATCACAGCAGG -3'

Posted On

2015-10-21