Incidental Mutation 'R4684:Arhgef4'
ID353483
Institutional Source Beutler Lab
Gene Symbol Arhgef4
Ensembl Gene ENSMUSG00000037509
Gene NameRho guanine nucleotide exchange factor (GEF) 4
Synonyms9330140K16Rik, Asef
Accession Numbers

Genbank: NM_183019; MGI: 2442507; Ensembl: ENSMUSG00000070955

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4684 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location34678188-34813309 bp(+) (GRCm38)
Type of Mutationunclassified (1434 bp from exon)
DNA Base Change (assembly) A to T at 34811785 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000131720 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047534] [ENSMUST00000047664] [ENSMUST00000159021] [ENSMUST00000159747] [ENSMUST00000160855] [ENSMUST00000162599] [ENSMUST00000167518]
Predicted Effect probably null
Transcript: ENSMUST00000047534
SMART Domains Protein: ENSMUSP00000042212
Gene: ENSMUSG00000037503

DomainStartEndE-ValueType
Pfam:TCRP1 1 194 1e-108 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000047664
AA Change: N471Y

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000035980
Gene: ENSMUSG00000037509
AA Change: N471Y

DomainStartEndE-ValueType
SH3 1 45 6.97e-7 SMART
RhoGEF 82 261 3.86e-56 SMART
PH 294 402 2.33e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159021
SMART Domains Protein: ENSMUSP00000124467
Gene: ENSMUSG00000037509

DomainStartEndE-ValueType
SH3 1 45 6.97e-7 SMART
Pfam:RhoGEF 82 190 3.4e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159747
AA Change: N1842Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124213
Gene: ENSMUSG00000037509
AA Change: N1842Y

DomainStartEndE-ValueType
low complexity region 15 28 N/A INTRINSIC
low complexity region 573 584 N/A INTRINSIC
low complexity region 686 712 N/A INTRINSIC
low complexity region 915 926 N/A INTRINSIC
low complexity region 1119 1137 N/A INTRINSIC
low complexity region 1240 1254 N/A INTRINSIC
SH3 1361 1416 3.73e-16 SMART
RhoGEF 1453 1632 3.86e-56 SMART
PH 1665 1773 2.33e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160855
SMART Domains Protein: ENSMUSP00000124207
Gene: ENSMUSG00000037509

DomainStartEndE-ValueType
SH3 1 45 6.97e-7 SMART
Pfam:RhoGEF 82 187 1.2e-21 PFAM
low complexity region 194 211 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162599
AA Change: N615Y

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124906
Gene: ENSMUSG00000037509
AA Change: N615Y

DomainStartEndE-ValueType
low complexity region 73 87 N/A INTRINSIC
SH3 194 249 3.73e-16 SMART
Pfam:RhoGEF 304 405 1.2e-25 PFAM
PH 438 546 2.33e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162760
Predicted Effect probably null
Transcript: ENSMUST00000167518
SMART Domains Protein: ENSMUSP00000131720
Gene: ENSMUSG00000037503

DomainStartEndE-ValueType
Pfam:TCRP1 1 62 3.3e-26 PFAM
Pfam:TCRP1 54 206 1.1e-89 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193040
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein coupled receptors. The protein encoded by this gene may form complex with G proteins and stimulate Rho-dependent signals. Multiple alternatively spliced transcript variants encoding different isoforms have been found, but the full-length nature of some variants has not been determined. [provided by RefSeq, Jun 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased angiogenesis, vascular endothelial cell migration, tumor growth, and tumor vascularization. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310039H08Rik T C 17: 46,772,946 V45A probably benign Het
4921509C19Rik A G 2: 151,471,871 I629T unknown Het
4933402N03Rik T C 7: 131,138,684 R268G probably damaging Het
Abca13 A T 11: 9,434,193 R3882* probably null Het
Adamts3 T G 5: 89,703,007 T558P probably damaging Het
Ano2 A G 6: 125,790,341 N214S probably benign Het
Boc C T 16: 44,500,380 A306T probably benign Het
Capn10 T C 1: 92,943,781 F367S probably damaging Het
Ccdc6 T C 10: 70,189,256 probably benign Het
Cobll1 G T 2: 65,099,028 S688R possibly damaging Het
Cpxm2 G T 7: 132,049,038 P631Q possibly damaging Het
Cyp2c68 A G 19: 39,699,335 V406A possibly damaging Het
Cyp4a30b T A 4: 115,455,003 Y118N probably damaging Het
Dgki A T 6: 37,299,846 probably benign Het
Disp2 A G 2: 118,792,756 N1323S probably damaging Het
Dock1 T A 7: 134,724,409 Y42* probably null Het
Eps8l1 C A 7: 4,473,945 P471Q probably damaging Het
Fam20a A C 11: 109,721,687 L10R unknown Het
Fpr-rs4 T A 17: 18,022,184 I151K probably damaging Het
Gga1 C A 15: 78,885,309 P161T probably damaging Het
Gm8909 A T 17: 36,165,858 H241Q possibly damaging Het
Gm9923 T A 10: 72,309,476 Y52* probably null Het
Gucy2g A G 19: 55,206,256 F910L probably damaging Het
Helz T C 11: 107,649,145 V315A probably damaging Het
Hk2 T C 6: 82,739,648 Y301C probably damaging Het
Htt C T 5: 34,852,765 P1521S probably damaging Het
Iah1 T C 12: 21,316,433 M1T probably null Het
Ik T C 18: 36,752,414 S287P probably damaging Het
Itga1 T A 13: 115,049,370 D32V probably damaging Het
Itpr2 A G 6: 146,373,173 F837S probably damaging Het
Klk14 A G 7: 43,691,968 I15V probably benign Het
Kng2 T C 16: 22,987,641 I603V possibly damaging Het
Lama1 T C 17: 67,773,778 I1267T possibly damaging Het
Lrp1b A C 2: 40,922,304 L2430V probably benign Het
Lrrn3 T G 12: 41,454,244 K25Q possibly damaging Het
Lta4h T A 10: 93,468,816 N233K probably benign Het
Mapk13 T C 17: 28,770,049 I53T probably damaging Het
Mdn1 T C 4: 32,666,430 F123L probably damaging Het
Mettl7b G T 10: 128,960,702 C79* probably null Het
Myh4 G C 11: 67,245,811 D472H probably damaging Het
Nipa2 A T 7: 55,935,826 N121K probably benign Het
Nostrin C T 2: 69,183,924 T408M probably benign Het
Olfr347 A G 2: 36,734,674 M118V probably damaging Het
Olfr725 T C 14: 50,034,830 D191G probably damaging Het
Oosp2 C T 19: 11,649,653 R102H probably damaging Het
Osgin2 T A 4: 16,001,946 I202L probably benign Het
Pbld2 C A 10: 63,057,697 R271S probably damaging Het
Pex6 C T 17: 46,712,101 T201I probably benign Het
Pilra T C 5: 137,835,515 I96M probably damaging Het
Pllp T A 8: 94,677,278 D47V possibly damaging Het
Plxna2 A G 1: 194,762,594 S765G probably benign Het
Prkca A T 11: 107,961,608 Y100N probably damaging Het
Prkg1 T A 19: 31,664,179 K35* probably null Het
Psmc2 A G 5: 21,803,265 D389G possibly damaging Het
Rnf213 A G 11: 119,441,125 T2387A probably damaging Het
Ros1 T C 10: 52,129,096 N914S probably damaging Het
Ruvbl1 C A 6: 88,491,599 T367K probably benign Het
Scube2 C T 7: 109,810,713 R525H probably damaging Het
Sec14l4 T C 11: 4,035,200 probably null Het
Secisbp2l T C 2: 125,745,942 D751G probably damaging Het
Setd3 T C 12: 108,108,690 D402G probably benign Het
Slc15a2 T A 16: 36,757,849 K359N probably damaging Het
Slc25a21 A G 12: 57,196,936 S2P probably benign Het
Slfn8 A T 11: 83,017,506 H70Q probably benign Het
Spef2 T C 15: 9,647,490 I944V probably benign Het
Spg11 A G 2: 122,065,076 F1887S probably damaging Het
Sptbn4 T C 7: 27,364,419 E879G probably damaging Het
Sptbn4 A T 7: 27,366,735 D649E possibly damaging Het
Stx5a C A 19: 8,743,361 R121S probably damaging Het
Tbcd T C 11: 121,493,771 L26P probably damaging Het
Tecpr1 T C 5: 144,207,437 D649G probably benign Het
Tfam A G 10: 71,237,847 S32P probably benign Het
Trmt44 C T 5: 35,558,043 R642H probably benign Het
Trpm3 G A 19: 22,987,781 A1547T probably benign Het
Ttll6 T C 11: 96,153,177 V519A probably benign Het
Umodl1 T C 17: 30,998,114 F1107L probably benign Het
Usp5 A T 6: 124,817,956 V677E probably damaging Het
Utp20 A T 10: 88,807,445 L605* probably null Het
Utrn T C 10: 12,745,240 D229G probably damaging Het
Uty A T Y: 1,176,502 L178* probably null Het
Vmn2r88 A T 14: 51,413,334 D168V possibly damaging Het
Vps13b T C 15: 35,646,178 V1476A probably damaging Het
Vps13b C T 15: 35,841,341 H2506Y probably benign Het
Vps13b C A 15: 35,879,821 T3014K probably benign Het
Vps37c T C 19: 10,712,768 V198A probably benign Het
Zfc3h1 T C 10: 115,423,385 Y1621H probably benign Het
Zfp251 T C 15: 76,854,407 D162G possibly damaging Het
Zfp292 T C 4: 34,807,078 T1994A probably benign Het
Zfp791 A G 8: 85,110,930 Y102H probably benign Het
Other mutations in Arhgef4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Arhgef4 APN 1 34811696 missense possibly damaging 0.88
IGL02376:Arhgef4 APN 1 34806059 missense probably damaging 1.00
IGL02604:Arhgef4 APN 1 34811723 nonsense probably null
IGL03240:Arhgef4 APN 1 34806026 missense probably benign 0.03
R0095:Arhgef4 UTSW 1 34732370 nonsense probably null
R0157:Arhgef4 UTSW 1 34806394 missense probably damaging 1.00
R0243:Arhgef4 UTSW 1 34806999 intron probably null
R0383:Arhgef4 UTSW 1 34810533 missense probably damaging 1.00
R0440:Arhgef4 UTSW 1 34745448 splice site probably null
R0452:Arhgef4 UTSW 1 34732322 missense probably damaging 0.97
R0893:Arhgef4 UTSW 1 34807110 missense probably damaging 1.00
R1429:Arhgef4 UTSW 1 34810339 missense probably damaging 1.00
R1437:Arhgef4 UTSW 1 34723945 missense unknown
R1669:Arhgef4 UTSW 1 34732158 missense possibly damaging 0.86
R1780:Arhgef4 UTSW 1 34724160 missense possibly damaging 0.73
R1809:Arhgef4 UTSW 1 34810555 critical splice donor site probably null
R1879:Arhgef4 UTSW 1 34722440 missense unknown
R1908:Arhgef4 UTSW 1 34724259 missense probably benign 0.01
R1919:Arhgef4 UTSW 1 34811140 missense probably damaging 0.98
R2020:Arhgef4 UTSW 1 34723810 missense unknown
R2058:Arhgef4 UTSW 1 34722377 missense unknown
R2213:Arhgef4 UTSW 1 34807149 unclassified probably null
R2851:Arhgef4 UTSW 1 34724048 missense unknown
R2852:Arhgef4 UTSW 1 34724048 missense unknown
R2853:Arhgef4 UTSW 1 34724048 missense unknown
R3697:Arhgef4 UTSW 1 34722440 missense unknown
R4012:Arhgef4 UTSW 1 34725106 missense possibly damaging 0.75
R4118:Arhgef4 UTSW 1 34732347 missense probably damaging 0.98
R4133:Arhgef4 UTSW 1 34806104 missense probably damaging 1.00
R4534:Arhgef4 UTSW 1 34723081 missense unknown
R4535:Arhgef4 UTSW 1 34723081 missense unknown
R4581:Arhgef4 UTSW 1 34732124 missense possibly damaging 0.83
R4665:Arhgef4 UTSW 1 34806032 missense possibly damaging 0.89
R4678:Arhgef4 UTSW 1 34722668 missense unknown
R4706:Arhgef4 UTSW 1 34732217 missense probably benign 0.00
R4745:Arhgef4 UTSW 1 34807275 missense probably damaging 1.00
R4747:Arhgef4 UTSW 1 34723274 missense unknown
R4988:Arhgef4 UTSW 1 34723454 missense unknown
R5063:Arhgef4 UTSW 1 34724215 missense probably benign 0.00
R5154:Arhgef4 UTSW 1 34732374 missense probably benign 0.43
R5156:Arhgef4 UTSW 1 34723274 missense unknown
R5263:Arhgef4 UTSW 1 34724997 missense possibly damaging 0.84
R5450:Arhgef4 UTSW 1 34807324 intron probably benign
R5807:Arhgef4 UTSW 1 34807615 intron probably benign
R5863:Arhgef4 UTSW 1 34722845 missense unknown
R6034:Arhgef4 UTSW 1 34721903 missense unknown
R6034:Arhgef4 UTSW 1 34721903 missense unknown
R6311:Arhgef4 UTSW 1 34723981 missense unknown
R6315:Arhgef4 UTSW 1 34723477 missense unknown
R6316:Arhgef4 UTSW 1 34723477 missense unknown
R6318:Arhgef4 UTSW 1 34723477 missense unknown
R6323:Arhgef4 UTSW 1 34723477 missense unknown
R6324:Arhgef4 UTSW 1 34723477 missense unknown
R6325:Arhgef4 UTSW 1 34723477 missense unknown
R6340:Arhgef4 UTSW 1 34732223 missense probably damaging 1.00
R6835:Arhgef4 UTSW 1 34806493 missense probably damaging 1.00
R6981:Arhgef4 UTSW 1 34722452 missense unknown
R7087:Arhgef4 UTSW 1 34811686 missense probably damaging 0.96
R7297:Arhgef4 UTSW 1 34807192 missense probably damaging 1.00
R7525:Arhgef4 UTSW 1 34809704 missense probably damaging 1.00
R7614:Arhgef4 UTSW 1 34732235 missense possibly damaging 0.67
R7693:Arhgef4 UTSW 1 34724141 missense probably benign 0.01
R7892:Arhgef4 UTSW 1 34721804 missense unknown
R7895:Arhgef4 UTSW 1 34806397 missense probably damaging 1.00
R7975:Arhgef4 UTSW 1 34721804 missense unknown
R7978:Arhgef4 UTSW 1 34806397 missense probably damaging 1.00
RF012:Arhgef4 UTSW 1 34724484 small deletion probably benign
X0062:Arhgef4 UTSW 1 34724227 missense probably benign 0.35
YA93:Arhgef4 UTSW 1 34732217 missense probably benign 0.00
Z1176:Arhgef4 UTSW 1 34723729 missense not run
Z1176:Arhgef4 UTSW 1 34804926 missense not run
Z1177:Arhgef4 UTSW 1 34722921 missense not run
Z1177:Arhgef4 UTSW 1 34723366 missense not run
Z1177:Arhgef4 UTSW 1 34724259 missense not run
Predicted Primers PCR Primer
(F):5'- CACAAACAGGCCCCTTTGTC -3'
(R):5'- AGAGGCTGGTACTCACACACTAG -3'

Sequencing Primer
(F):5'- AACAGGCCCCTTTGTCTGCTAC -3'
(R):5'- TGGTACTCACACACTAGCCATGG -3'
Posted On2015-10-21