Mutagenetix > Incidental Mutations

Incidental Mutation 'R4684:Arhgef4'

353483

Institutional Source

Beutler Lab

Gene Symbol

Arhgef4

Ensembl Gene

ENSMUSG00000037509

Gene Name

Rho guanine nucleotide exchange factor (GEF) 4

Synonyms

9330140K16Rik, Asef

Accession Numbers

Genbank: NM_183019; MGI: 2442507; Ensembl: ENSMUSG00000070955

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4684 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

34678188-34813309 bp(+) (GRCm38)

Type of Mutation

splice site (1434 bp from exon)

DNA Base Change (assembly)

A to T at 34811785 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000131720 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047534] [ENSMUST00000047664] [ENSMUST00000159021] [ENSMUST00000159747] [ENSMUST00000160855] [ENSMUST00000162599] [ENSMUST00000167518]

Predicted Effect

probably null
Transcript: ENSMUST00000047534

SMART Domains

Protein: ENSMUSP00000042212
Gene: ENSMUSG00000037503

Domain	Start	End	E-Value	Type
Pfam:TCRP1	1	194	1e-108	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000047664
AA Change: N471Y

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000035980
Gene: ENSMUSG00000037509
AA Change: N471Y

Domain	Start	End	E-Value	Type
SH3	1	45	6.97e-7	SMART
RhoGEF	82	261	3.86e-56	SMART
PH	294	402	2.33e-14	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000159021

SMART Domains

Protein: ENSMUSP00000124467
Gene: ENSMUSG00000037509

Domain	Start	End	E-Value	Type
SH3	1	45	6.97e-7	SMART
Pfam:RhoGEF	82	190	3.4e-29	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000159747
AA Change: N1842Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000124213
Gene: ENSMUSG00000037509
AA Change: N1842Y

Domain	Start	End	E-Value	Type
low complexity region	15	28	N/A	INTRINSIC
low complexity region	573	584	N/A	INTRINSIC
low complexity region	686	712	N/A	INTRINSIC
low complexity region	915	926	N/A	INTRINSIC
low complexity region	1119	1137	N/A	INTRINSIC
low complexity region	1240	1254	N/A	INTRINSIC
SH3	1361	1416	3.73e-16	SMART
RhoGEF	1453	1632	3.86e-56	SMART
PH	1665	1773	2.33e-14	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000160855

SMART Domains

Protein: ENSMUSP00000124207
Gene: ENSMUSG00000037509

Domain	Start	End	E-Value	Type
SH3	1	45	6.97e-7	SMART
Pfam:RhoGEF	82	187	1.2e-21	PFAM
low complexity region	194	211	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000162599
AA Change: N615Y

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000124906
Gene: ENSMUSG00000037509
AA Change: N615Y

Domain	Start	End	E-Value	Type
low complexity region	73	87	N/A	INTRINSIC
SH3	194	249	3.73e-16	SMART
Pfam:RhoGEF	304	405	1.2e-25	PFAM
PH	438	546	2.33e-14	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162760

Predicted Effect

probably null
Transcript: ENSMUST00000167518

SMART Domains

Protein: ENSMUSP00000131720
Gene: ENSMUSG00000037503

Domain	Start	End	E-Value	Type
Pfam:TCRP1	1	62	3.3e-26	PFAM
Pfam:TCRP1	54	206	1.1e-89	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193040

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein coupled receptors. The protein encoded by this gene may form complex with G proteins and stimulate Rho-dependent signals. Multiple alternatively spliced transcript variants encoding different isoforms have been found, but the full-length nature of some variants has not been determined. [provided by RefSeq, Jun 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased angiogenesis, vascular endothelial cell migration, tumor growth, and tumor vascularization. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310039H08Rik	T	C	17: 46,772,946	V45A	probably benign	Het
4921509C19Rik	A	G	2: 151,471,871	I629T	unknown	Het
4933402N03Rik	T	C	7: 131,138,684	R268G	probably damaging	Het
Abca13	A	T	11: 9,434,193	R3882*	probably null	Het
Adamts3	T	G	5: 89,703,007	T558P	probably damaging	Het
Ano2	A	G	6: 125,790,341	N214S	probably benign	Het
Boc	C	T	16: 44,500,380	A306T	probably benign	Het
Capn10	T	C	1: 92,943,781	F367S	probably damaging	Het
Ccdc6	T	C	10: 70,189,256		probably benign	Het
Cobll1	G	T	2: 65,099,028	S688R	possibly damaging	Het
Cpxm2	G	T	7: 132,049,038	P631Q	possibly damaging	Het
Cyp2c68	A	G	19: 39,699,335	V406A	possibly damaging	Het
Cyp4a30b	T	A	4: 115,455,003	Y118N	probably damaging	Het
Dgki	A	T	6: 37,299,846		probably benign	Het
Disp2	A	G	2: 118,792,756	N1323S	probably damaging	Het
Dock1	T	A	7: 134,724,409	Y42*	probably null	Het
Eps8l1	C	A	7: 4,473,945	P471Q	probably damaging	Het
Fam20a	A	C	11: 109,721,687	L10R	unknown	Het
Fpr-rs4	T	A	17: 18,022,184	I151K	probably damaging	Het
Gga1	C	A	15: 78,885,309	P161T	probably damaging	Het
Gm8909	A	T	17: 36,165,858	H241Q	possibly damaging	Het
Gm9923	T	A	10: 72,309,476	Y52*	probably null	Het
Gucy2g	A	G	19: 55,206,256	F910L	probably damaging	Het
Helz	T	C	11: 107,649,145	V315A	probably damaging	Het
Hk2	T	C	6: 82,739,648	Y301C	probably damaging	Het
Htt	C	T	5: 34,852,765	P1521S	probably damaging	Het
Iah1	T	C	12: 21,316,433	M1T	probably null	Het
Ik	T	C	18: 36,752,414	S287P	probably damaging	Het
Itga1	T	A	13: 115,049,370	D32V	probably damaging	Het
Itpr2	A	G	6: 146,373,173	F837S	probably damaging	Het
Klk14	A	G	7: 43,691,968	I15V	probably benign	Het
Kng2	T	C	16: 22,987,641	I603V	possibly damaging	Het
Lama1	T	C	17: 67,773,778	I1267T	possibly damaging	Het
Lrp1b	A	C	2: 40,922,304	L2430V	probably benign	Het
Lrrn3	T	G	12: 41,454,244	K25Q	possibly damaging	Het
Lta4h	T	A	10: 93,468,816	N233K	probably benign	Het
Mapk13	T	C	17: 28,770,049	I53T	probably damaging	Het
Mdn1	T	C	4: 32,666,430	F123L	probably damaging	Het
Mettl7b	G	T	10: 128,960,702	C79*	probably null	Het
Myh4	G	C	11: 67,245,811	D472H	probably damaging	Het
Nipa2	A	T	7: 55,935,826	N121K	probably benign	Het
Nostrin	C	T	2: 69,183,924	T408M	probably benign	Het
Olfr347	A	G	2: 36,734,674	M118V	probably damaging	Het
Olfr725	T	C	14: 50,034,830	D191G	probably damaging	Het
Oosp2	C	T	19: 11,649,653	R102H	probably damaging	Het
Osgin2	T	A	4: 16,001,946	I202L	probably benign	Het
Pbld2	C	A	10: 63,057,697	R271S	probably damaging	Het
Pex6	C	T	17: 46,712,101	T201I	probably benign	Het
Pilra	T	C	5: 137,835,515	I96M	probably damaging	Het
Pllp	T	A	8: 94,677,278	D47V	possibly damaging	Het
Plxna2	A	G	1: 194,762,594	S765G	probably benign	Het
Prkca	A	T	11: 107,961,608	Y100N	probably damaging	Het
Prkg1	T	A	19: 31,664,179	K35*	probably null	Het
Psmc2	A	G	5: 21,803,265	D389G	possibly damaging	Het
Rnf213	A	G	11: 119,441,125	T2387A	probably damaging	Het
Ros1	T	C	10: 52,129,096	N914S	probably damaging	Het
Ruvbl1	C	A	6: 88,491,599	T367K	probably benign	Het
Scube2	C	T	7: 109,810,713	R525H	probably damaging	Het
Sec14l4	T	C	11: 4,035,200		probably null	Het
Secisbp2l	T	C	2: 125,745,942	D751G	probably damaging	Het
Setd3	T	C	12: 108,108,690	D402G	probably benign	Het
Slc15a2	T	A	16: 36,757,849	K359N	probably damaging	Het
Slc25a21	A	G	12: 57,196,936	S2P	probably benign	Het
Slfn8	A	T	11: 83,017,506	H70Q	probably benign	Het
Spef2	T	C	15: 9,647,490	I944V	probably benign	Het
Spg11	A	G	2: 122,065,076	F1887S	probably damaging	Het
Sptbn4	T	C	7: 27,364,419	E879G	probably damaging	Het
Sptbn4	A	T	7: 27,366,735	D649E	possibly damaging	Het
Stx5a	C	A	19: 8,743,361	R121S	probably damaging	Het
Tbcd	T	C	11: 121,493,771	L26P	probably damaging	Het
Tecpr1	T	C	5: 144,207,437	D649G	probably benign	Het
Tfam	A	G	10: 71,237,847	S32P	probably benign	Het
Trmt44	C	T	5: 35,558,043	R642H	probably benign	Het
Trpm3	G	A	19: 22,987,781	A1547T	probably benign	Het
Ttll6	T	C	11: 96,153,177	V519A	probably benign	Het
Umodl1	T	C	17: 30,998,114	F1107L	probably benign	Het
Usp5	A	T	6: 124,817,956	V677E	probably damaging	Het
Utp20	A	T	10: 88,807,445	L605*	probably null	Het
Utrn	T	C	10: 12,745,240	D229G	probably damaging	Het
Uty	A	T	Y: 1,176,502	L178*	probably null	Het
Vmn2r88	A	T	14: 51,413,334	D168V	possibly damaging	Het
Vps13b	T	C	15: 35,646,178	V1476A	probably damaging	Het
Vps13b	C	T	15: 35,841,341	H2506Y	probably benign	Het
Vps13b	C	A	15: 35,879,821	T3014K	probably benign	Het
Vps37c	T	C	19: 10,712,768	V198A	probably benign	Het
Zfc3h1	T	C	10: 115,423,385	Y1621H	probably benign	Het
Zfp251	T	C	15: 76,854,407	D162G	possibly damaging	Het
Zfp292	T	C	4: 34,807,078	T1994A	probably benign	Het
Zfp791	A	G	8: 85,110,930	Y102H	probably benign	Het

Other mutations in Arhgef4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00896:Arhgef4	APN	1	34811696	missense	possibly damaging	0.88
IGL02376:Arhgef4	APN	1	34806059	missense	probably damaging	1.00
IGL02604:Arhgef4	APN	1	34811723	nonsense	probably null
IGL03240:Arhgef4	APN	1	34806026	missense	probably benign	0.03
BB004:Arhgef4	UTSW	1	34807253	missense	probably damaging	1.00
BB014:Arhgef4	UTSW	1	34807253	missense	probably damaging	1.00
R0095:Arhgef4	UTSW	1	34732370	nonsense	probably null
R0157:Arhgef4	UTSW	1	34806394	missense	probably damaging	1.00
R0243:Arhgef4	UTSW	1	34806999	splice site	probably null
R0383:Arhgef4	UTSW	1	34810533	missense	probably damaging	1.00
R0440:Arhgef4	UTSW	1	34745448	splice site	probably null
R0452:Arhgef4	UTSW	1	34732322	missense	probably damaging	0.97
R0893:Arhgef4	UTSW	1	34807110	missense	probably damaging	1.00
R1429:Arhgef4	UTSW	1	34810339	missense	probably damaging	1.00
R1437:Arhgef4	UTSW	1	34723945	missense	unknown
R1669:Arhgef4	UTSW	1	34732158	missense	possibly damaging	0.86
R1780:Arhgef4	UTSW	1	34724160	missense	possibly damaging	0.73
R1809:Arhgef4	UTSW	1	34810555	critical splice donor site	probably null
R1879:Arhgef4	UTSW	1	34722440	missense	unknown
R1908:Arhgef4	UTSW	1	34724259	missense	probably benign	0.01
R1919:Arhgef4	UTSW	1	34811140	missense	probably damaging	0.98
R2020:Arhgef4	UTSW	1	34723810	missense	unknown
R2058:Arhgef4	UTSW	1	34722377	missense	unknown
R2213:Arhgef4	UTSW	1	34807149	splice site	probably null
R2851:Arhgef4	UTSW	1	34724048	missense	unknown
R2852:Arhgef4	UTSW	1	34724048	missense	unknown
R2853:Arhgef4	UTSW	1	34724048	missense	unknown
R3697:Arhgef4	UTSW	1	34722440	missense	unknown
R4012:Arhgef4	UTSW	1	34725106	missense	possibly damaging	0.75
R4118:Arhgef4	UTSW	1	34732347	missense	probably damaging	0.98
R4133:Arhgef4	UTSW	1	34806104	missense	probably damaging	1.00
R4534:Arhgef4	UTSW	1	34723081	missense	unknown
R4535:Arhgef4	UTSW	1	34723081	missense	unknown
R4581:Arhgef4	UTSW	1	34732124	missense	possibly damaging	0.83
R4665:Arhgef4	UTSW	1	34806032	missense	possibly damaging	0.89
R4678:Arhgef4	UTSW	1	34722668	missense	unknown
R4706:Arhgef4	UTSW	1	34732217	missense	probably benign	0.00
R4745:Arhgef4	UTSW	1	34807275	missense	probably damaging	1.00
R4747:Arhgef4	UTSW	1	34723274	missense	unknown
R4988:Arhgef4	UTSW	1	34723454	missense	unknown
R5063:Arhgef4	UTSW	1	34724215	missense	probably benign	0.00
R5154:Arhgef4	UTSW	1	34732374	missense	probably benign	0.43
R5156:Arhgef4	UTSW	1	34723274	missense	unknown
R5263:Arhgef4	UTSW	1	34724997	missense	possibly damaging	0.84
R5450:Arhgef4	UTSW	1	34807324	intron	probably benign
R5807:Arhgef4	UTSW	1	34807615	intron	probably benign
R5863:Arhgef4	UTSW	1	34722845	missense	unknown
R6034:Arhgef4	UTSW	1	34721903	missense	unknown
R6034:Arhgef4	UTSW	1	34721903	missense	unknown
R6311:Arhgef4	UTSW	1	34723981	missense	unknown
R6315:Arhgef4	UTSW	1	34723477	missense	unknown
R6316:Arhgef4	UTSW	1	34723477	missense	unknown
R6318:Arhgef4	UTSW	1	34723477	missense	unknown
R6323:Arhgef4	UTSW	1	34723477	missense	unknown
R6324:Arhgef4	UTSW	1	34723477	missense	unknown
R6325:Arhgef4	UTSW	1	34723477	missense	unknown
R6340:Arhgef4	UTSW	1	34732223	missense	probably damaging	1.00
R6835:Arhgef4	UTSW	1	34806493	missense	probably damaging	1.00
R6981:Arhgef4	UTSW	1	34722452	missense	unknown
R7087:Arhgef4	UTSW	1	34811686	missense	probably damaging	0.96
R7297:Arhgef4	UTSW	1	34807192	missense	probably damaging	1.00
R7525:Arhgef4	UTSW	1	34809704	missense	probably damaging	1.00
R7614:Arhgef4	UTSW	1	34732235	missense	possibly damaging	0.67
R7693:Arhgef4	UTSW	1	34724141	missense	probably benign	0.01
R7892:Arhgef4	UTSW	1	34721804	missense	unknown
R7895:Arhgef4	UTSW	1	34806397	missense	probably damaging	1.00
R7927:Arhgef4	UTSW	1	34807253	missense	probably damaging	1.00
R7965:Arhgef4	UTSW	1	34811681	missense	probably benign
R7973:Arhgef4	UTSW	1	34724437	missense	possibly damaging	0.83
R7979:Arhgef4	UTSW	1	34721897	missense	unknown
R8160:Arhgef4	UTSW	1	34723574	missense	unknown
R8175:Arhgef4	UTSW	1	34810374	missense	probably benign
R8178:Arhgef4	UTSW	1	34722902	missense	unknown
RF012:Arhgef4	UTSW	1	34724484	small deletion	probably benign
X0062:Arhgef4	UTSW	1	34724227	missense	probably benign	0.35
YA93:Arhgef4	UTSW	1	34732217	missense	probably benign	0.00
Z1176:Arhgef4	UTSW	1	34723729	missense	unknown
Z1176:Arhgef4	UTSW	1	34804926	missense	probably damaging	1.00
Z1177:Arhgef4	UTSW	1	34722921	missense	unknown
Z1177:Arhgef4	UTSW	1	34723366	missense	unknown
Z1177:Arhgef4	UTSW	1	34724259	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- CACAAACAGGCCCCTTTGTC -3'
(R):5'- AGAGGCTGGTACTCACACACTAG -3'

Sequencing Primer
(F):5'- AACAGGCCCCTTTGTCTGCTAC -3'
(R):5'- TGGTACTCACACACTAGCCATGG -3'

Posted On

2015-10-21