Incidental Mutation 'R4684:Zfp292'
ID 353497
Institutional Source Beutler Lab
Gene Symbol Zfp292
Ensembl Gene ENSMUSG00000039967
Gene Name zinc finger protein 292
Synonyms Zfp-15, 9430062L07Rik, Zn-16, Zfp15, Zn-15, 5730450D02Rik, Krox-10
Accession Numbers
Essential gene? Probably essential (E-score: 0.861) question?
Stock # R4684 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 34803113-34882960 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 34807078 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1994 (T1994A)
Ref Sequence ENSEMBL: ENSMUSP00000037233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047950] [ENSMUST00000098163]
AlphaFold Q9Z2U2
Predicted Effect probably benign
Transcript: ENSMUST00000047950
AA Change: T1994A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000037233
Gene: ENSMUSG00000039967
AA Change: T1994A

DomainStartEndE-ValueType
low complexity region 19 39 N/A INTRINSIC
low complexity region 101 120 N/A INTRINSIC
low complexity region 512 523 N/A INTRINSIC
ZnF_C2H2 540 561 5.12e1 SMART
ZnF_C2H2 567 589 4.72e-2 SMART
low complexity region 649 664 N/A INTRINSIC
ZnF_C2H2 681 705 3.52e-1 SMART
ZnF_C2H2 722 744 1.53e-1 SMART
ZnF_C2H2 750 774 1.62e0 SMART
ZnF_C2H2 779 803 1.08e1 SMART
ZnF_C2H2 807 831 1.95e-3 SMART
low complexity region 1062 1078 N/A INTRINSIC
ZnF_C2H2 1085 1110 7.67e-2 SMART
ZnF_C2H2 1361 1381 1.93e2 SMART
low complexity region 1606 1618 N/A INTRINSIC
ZnF_C2H2 1879 1904 4.4e-2 SMART
ZnF_C2H2 1924 1949 5.42e-2 SMART
low complexity region 2004 2014 N/A INTRINSIC
low complexity region 2024 2037 N/A INTRINSIC
coiled coil region 2050 2072 N/A INTRINSIC
ZnF_C2H2 2091 2116 4.45e0 SMART
low complexity region 2121 2143 N/A INTRINSIC
ZnF_C2H2 2149 2174 1.64e-1 SMART
ZnF_C2H2 2193 2218 3.24e0 SMART
ZnF_C2H2 2233 2258 1.18e-2 SMART
low complexity region 2301 2314 N/A INTRINSIC
ZnF_C2H2 2362 2386 2.86e-1 SMART
low complexity region 2589 2605 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098163
AA Change: T1989A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000095766
Gene: ENSMUSG00000039967
AA Change: T1989A

DomainStartEndE-ValueType
low complexity region 19 39 N/A INTRINSIC
low complexity region 101 120 N/A INTRINSIC
low complexity region 507 518 N/A INTRINSIC
ZnF_C2H2 535 556 5.12e1 SMART
ZnF_C2H2 562 584 4.72e-2 SMART
low complexity region 644 659 N/A INTRINSIC
ZnF_C2H2 676 700 3.52e-1 SMART
ZnF_C2H2 717 739 1.53e-1 SMART
ZnF_C2H2 745 769 1.62e0 SMART
ZnF_C2H2 774 798 1.08e1 SMART
ZnF_C2H2 802 826 1.95e-3 SMART
low complexity region 1057 1073 N/A INTRINSIC
ZnF_C2H2 1080 1105 7.67e-2 SMART
ZnF_C2H2 1356 1376 1.93e2 SMART
low complexity region 1601 1613 N/A INTRINSIC
ZnF_C2H2 1874 1899 4.4e-2 SMART
ZnF_C2H2 1919 1944 5.42e-2 SMART
low complexity region 1999 2009 N/A INTRINSIC
low complexity region 2019 2032 N/A INTRINSIC
coiled coil region 2045 2067 N/A INTRINSIC
ZnF_C2H2 2086 2111 4.45e0 SMART
low complexity region 2116 2138 N/A INTRINSIC
ZnF_C2H2 2144 2169 1.64e-1 SMART
ZnF_C2H2 2188 2213 3.24e0 SMART
ZnF_C2H2 2228 2253 1.18e-2 SMART
low complexity region 2296 2309 N/A INTRINSIC
ZnF_C2H2 2357 2381 2.86e-1 SMART
low complexity region 2584 2600 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310039H08Rik T C 17: 47,083,872 (GRCm39) V45A probably benign Het
4921509C19Rik A G 2: 151,313,791 (GRCm39) I629T unknown Het
4933402N03Rik T C 7: 130,740,413 (GRCm39) R268G probably damaging Het
Abca13 A T 11: 9,384,193 (GRCm39) R3882* probably null Het
Adamts3 T G 5: 89,850,866 (GRCm39) T558P probably damaging Het
Ano2 A G 6: 125,767,304 (GRCm39) N214S probably benign Het
Arhgef4 A T 1: 34,850,866 (GRCm39) probably null Het
Boc C T 16: 44,320,743 (GRCm39) A306T probably benign Het
Capn10 T C 1: 92,871,503 (GRCm39) F367S probably damaging Het
Ccdc6 T C 10: 70,025,086 (GRCm39) probably benign Het
Cobll1 G T 2: 64,929,372 (GRCm39) S688R possibly damaging Het
Cpxm2 G T 7: 131,650,767 (GRCm39) P631Q possibly damaging Het
Cyp2c68 A G 19: 39,687,779 (GRCm39) V406A possibly damaging Het
Cyp4a30b T A 4: 115,312,200 (GRCm39) Y118N probably damaging Het
Dgki A T 6: 37,276,781 (GRCm39) probably benign Het
Disp2 A G 2: 118,623,237 (GRCm39) N1323S probably damaging Het
Dock1 T A 7: 134,326,138 (GRCm39) Y42* probably null Het
Eps8l1 C A 7: 4,476,944 (GRCm39) P471Q probably damaging Het
Fam20a A C 11: 109,612,513 (GRCm39) L10R unknown Het
Fpr-rs4 T A 17: 18,242,446 (GRCm39) I151K probably damaging Het
Gga1 C A 15: 78,769,509 (GRCm39) P161T probably damaging Het
Gm9923 T A 10: 72,145,306 (GRCm39) Y52* probably null Het
Gucy2g A G 19: 55,194,688 (GRCm39) F910L probably damaging Het
H2-T5 A T 17: 36,476,750 (GRCm39) H241Q possibly damaging Het
Helz T C 11: 107,539,971 (GRCm39) V315A probably damaging Het
Hk2 T C 6: 82,716,629 (GRCm39) Y301C probably damaging Het
Htt C T 5: 35,010,109 (GRCm39) P1521S probably damaging Het
Iah1 T C 12: 21,366,434 (GRCm39) M1T probably null Het
Ik T C 18: 36,885,467 (GRCm39) S287P probably damaging Het
Itga1 T A 13: 115,185,906 (GRCm39) D32V probably damaging Het
Itpr2 A G 6: 146,274,671 (GRCm39) F837S probably damaging Het
Klk14 A G 7: 43,341,392 (GRCm39) I15V probably benign Het
Kng2 T C 16: 22,806,391 (GRCm39) I603V possibly damaging Het
Lama1 T C 17: 68,080,773 (GRCm39) I1267T possibly damaging Het
Lrp1b A C 2: 40,812,316 (GRCm39) L2430V probably benign Het
Lrrn3 T G 12: 41,504,243 (GRCm39) K25Q possibly damaging Het
Lta4h T A 10: 93,304,678 (GRCm39) N233K probably benign Het
Mapk13 T C 17: 28,989,023 (GRCm39) I53T probably damaging Het
Mdn1 T C 4: 32,666,430 (GRCm39) F123L probably damaging Het
Myh4 G C 11: 67,136,637 (GRCm39) D472H probably damaging Het
Nipa2 A T 7: 55,585,574 (GRCm39) N121K probably benign Het
Nostrin C T 2: 69,014,268 (GRCm39) T408M probably benign Het
Oosp2 C T 19: 11,627,017 (GRCm39) R102H probably damaging Het
Or1j18 A G 2: 36,624,686 (GRCm39) M118V probably damaging Het
Or4k15b T C 14: 50,272,287 (GRCm39) D191G probably damaging Het
Osgin2 T A 4: 16,001,946 (GRCm39) I202L probably benign Het
Pbld2 C A 10: 62,893,476 (GRCm39) R271S probably damaging Het
Pex6 C T 17: 47,023,027 (GRCm39) T201I probably benign Het
Pilra T C 5: 137,833,777 (GRCm39) I96M probably damaging Het
Pllp T A 8: 95,403,906 (GRCm39) D47V possibly damaging Het
Plxna2 A G 1: 194,444,902 (GRCm39) S765G probably benign Het
Prkca A T 11: 107,852,434 (GRCm39) Y100N probably damaging Het
Prkg1 T A 19: 31,641,579 (GRCm39) K35* probably null Het
Psmc2 A G 5: 22,008,263 (GRCm39) D389G possibly damaging Het
Rnf213 A G 11: 119,331,951 (GRCm39) T2387A probably damaging Het
Ros1 T C 10: 52,005,192 (GRCm39) N914S probably damaging Het
Ruvbl1 C A 6: 88,468,581 (GRCm39) T367K probably benign Het
Scube2 C T 7: 109,409,920 (GRCm39) R525H probably damaging Het
Sec14l4 T C 11: 3,985,200 (GRCm39) probably null Het
Secisbp2l T C 2: 125,587,862 (GRCm39) D751G probably damaging Het
Setd3 T C 12: 108,074,949 (GRCm39) D402G probably benign Het
Slc15a2 T A 16: 36,578,211 (GRCm39) K359N probably damaging Het
Slc25a21 A G 12: 57,243,721 (GRCm39) S2P probably benign Het
Slfn8 A T 11: 82,908,332 (GRCm39) H70Q probably benign Het
Spef2 T C 15: 9,647,576 (GRCm39) I944V probably benign Het
Spg11 A G 2: 121,895,557 (GRCm39) F1887S probably damaging Het
Sptbn4 A T 7: 27,066,160 (GRCm39) D649E possibly damaging Het
Sptbn4 T C 7: 27,063,844 (GRCm39) E879G probably damaging Het
Stx5a C A 19: 8,720,725 (GRCm39) R121S probably damaging Het
Tbcd T C 11: 121,384,597 (GRCm39) L26P probably damaging Het
Tecpr1 T C 5: 144,144,255 (GRCm39) D649G probably benign Het
Tfam A G 10: 71,073,677 (GRCm39) S32P probably benign Het
Tmt1b G T 10: 128,796,571 (GRCm39) C79* probably null Het
Trmt44 C T 5: 35,715,387 (GRCm39) R642H probably benign Het
Trpm3 G A 19: 22,965,145 (GRCm39) A1547T probably benign Het
Ttll6 T C 11: 96,044,003 (GRCm39) V519A probably benign Het
Umodl1 T C 17: 31,217,088 (GRCm39) F1107L probably benign Het
Usp5 A T 6: 124,794,919 (GRCm39) V677E probably damaging Het
Utp20 A T 10: 88,643,307 (GRCm39) L605* probably null Het
Utrn T C 10: 12,620,984 (GRCm39) D229G probably damaging Het
Uty A T Y: 1,176,502 (GRCm39) L178* probably null Het
Vmn2r88 A T 14: 51,650,791 (GRCm39) D168V possibly damaging Het
Vps13b T C 15: 35,646,324 (GRCm39) V1476A probably damaging Het
Vps13b C A 15: 35,879,967 (GRCm39) T3014K probably benign Het
Vps13b C T 15: 35,841,487 (GRCm39) H2506Y probably benign Het
Vps37c T C 19: 10,690,132 (GRCm39) V198A probably benign Het
Zfc3h1 T C 10: 115,259,290 (GRCm39) Y1621H probably benign Het
Zfp251 T C 15: 76,738,607 (GRCm39) D162G possibly damaging Het
Zfp791 A G 8: 85,837,559 (GRCm39) Y102H probably benign Het
Other mutations in Zfp292
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Zfp292 APN 4 34,808,683 (GRCm39) missense probably benign 0.15
IGL00502:Zfp292 APN 4 34,809,775 (GRCm39) missense possibly damaging 0.63
IGL00539:Zfp292 APN 4 34,808,790 (GRCm39) missense probably damaging 0.98
IGL00676:Zfp292 APN 4 34,807,827 (GRCm39) missense probably damaging 0.99
IGL01068:Zfp292 APN 4 34,806,763 (GRCm39) missense probably damaging 1.00
IGL01311:Zfp292 APN 4 34,807,961 (GRCm39) missense probably benign 0.01
IGL01639:Zfp292 APN 4 34,809,048 (GRCm39) missense probably benign 0.04
IGL01688:Zfp292 APN 4 34,807,855 (GRCm39) missense possibly damaging 0.93
IGL02345:Zfp292 APN 4 34,809,244 (GRCm39) missense possibly damaging 0.94
IGL02444:Zfp292 APN 4 34,808,810 (GRCm39) missense possibly damaging 0.87
IGL02548:Zfp292 APN 4 34,805,416 (GRCm39) missense probably damaging 1.00
IGL02551:Zfp292 APN 4 34,806,462 (GRCm39) missense possibly damaging 0.93
IGL02702:Zfp292 APN 4 34,809,415 (GRCm39) missense probably benign 0.14
IGL02715:Zfp292 APN 4 34,819,542 (GRCm39) missense probably damaging 1.00
IGL03273:Zfp292 APN 4 34,806,163 (GRCm39) missense probably benign 0.00
F5770:Zfp292 UTSW 4 34,806,783 (GRCm39) missense possibly damaging 0.85
PIT4362001:Zfp292 UTSW 4 34,807,524 (GRCm39) missense probably benign 0.00
R0153:Zfp292 UTSW 4 34,811,185 (GRCm39) missense probably benign 0.26
R0184:Zfp292 UTSW 4 34,819,563 (GRCm39) missense probably damaging 1.00
R0295:Zfp292 UTSW 4 34,806,281 (GRCm39) missense probably damaging 1.00
R0367:Zfp292 UTSW 4 34,808,227 (GRCm39) missense probably benign 0.25
R0433:Zfp292 UTSW 4 34,839,959 (GRCm39) missense probably damaging 0.99
R0481:Zfp292 UTSW 4 34,810,059 (GRCm39) missense probably benign 0.28
R0555:Zfp292 UTSW 4 34,807,194 (GRCm39) missense probably damaging 1.00
R0597:Zfp292 UTSW 4 34,807,399 (GRCm39) missense probably benign 0.02
R0748:Zfp292 UTSW 4 34,816,424 (GRCm39) splice site probably benign
R0782:Zfp292 UTSW 4 34,839,382 (GRCm39) missense possibly damaging 0.94
R0834:Zfp292 UTSW 4 34,809,114 (GRCm39) missense probably benign 0.00
R0879:Zfp292 UTSW 4 34,811,218 (GRCm39) missense probably benign 0.00
R1083:Zfp292 UTSW 4 34,807,569 (GRCm39) missense probably damaging 0.98
R1343:Zfp292 UTSW 4 34,805,238 (GRCm39) missense probably damaging 0.98
R1498:Zfp292 UTSW 4 34,805,397 (GRCm39) missense possibly damaging 0.88
R1714:Zfp292 UTSW 4 34,808,935 (GRCm39) missense probably damaging 1.00
R1724:Zfp292 UTSW 4 34,811,237 (GRCm39) missense probably damaging 1.00
R1755:Zfp292 UTSW 4 34,811,043 (GRCm39) missense probably benign 0.02
R1837:Zfp292 UTSW 4 34,810,264 (GRCm39) missense probably damaging 0.98
R1914:Zfp292 UTSW 4 34,805,100 (GRCm39) missense possibly damaging 0.92
R1915:Zfp292 UTSW 4 34,805,100 (GRCm39) missense possibly damaging 0.92
R1936:Zfp292 UTSW 4 34,807,452 (GRCm39) missense probably benign 0.22
R2107:Zfp292 UTSW 4 34,808,593 (GRCm39) missense possibly damaging 0.86
R2108:Zfp292 UTSW 4 34,808,593 (GRCm39) missense possibly damaging 0.86
R2136:Zfp292 UTSW 4 34,810,266 (GRCm39) missense probably benign 0.13
R2182:Zfp292 UTSW 4 34,807,417 (GRCm39) missense probably damaging 1.00
R2186:Zfp292 UTSW 4 34,807,962 (GRCm39) missense probably benign 0.07
R2306:Zfp292 UTSW 4 34,809,468 (GRCm39) missense probably damaging 0.96
R2350:Zfp292 UTSW 4 34,811,281 (GRCm39) missense probably damaging 1.00
R2382:Zfp292 UTSW 4 34,806,426 (GRCm39) missense possibly damaging 0.91
R2872:Zfp292 UTSW 4 34,808,595 (GRCm39) missense probably damaging 1.00
R2872:Zfp292 UTSW 4 34,808,595 (GRCm39) missense probably damaging 1.00
R3018:Zfp292 UTSW 4 34,808,814 (GRCm39) missense probably damaging 0.99
R3812:Zfp292 UTSW 4 34,810,326 (GRCm39) missense probably damaging 0.98
R4006:Zfp292 UTSW 4 34,807,744 (GRCm39) missense probably benign 0.00
R4006:Zfp292 UTSW 4 34,809,611 (GRCm39) missense possibly damaging 0.62
R4060:Zfp292 UTSW 4 34,810,863 (GRCm39) missense probably damaging 1.00
R4062:Zfp292 UTSW 4 34,810,863 (GRCm39) missense probably damaging 1.00
R4063:Zfp292 UTSW 4 34,810,863 (GRCm39) missense probably damaging 1.00
R4064:Zfp292 UTSW 4 34,810,863 (GRCm39) missense probably damaging 1.00
R4207:Zfp292 UTSW 4 34,806,079 (GRCm39) missense probably benign 0.04
R4641:Zfp292 UTSW 4 34,807,828 (GRCm39) missense probably damaging 0.99
R4718:Zfp292 UTSW 4 34,819,521 (GRCm39) missense possibly damaging 0.92
R4865:Zfp292 UTSW 4 34,819,563 (GRCm39) missense probably damaging 1.00
R4870:Zfp292 UTSW 4 34,808,917 (GRCm39) missense probably damaging 1.00
R5097:Zfp292 UTSW 4 34,839,878 (GRCm39) missense possibly damaging 0.89
R5233:Zfp292 UTSW 4 34,809,755 (GRCm39) missense probably damaging 1.00
R5246:Zfp292 UTSW 4 34,805,842 (GRCm39) missense possibly damaging 0.76
R5369:Zfp292 UTSW 4 34,807,491 (GRCm39) missense possibly damaging 0.89
R5527:Zfp292 UTSW 4 34,806,261 (GRCm39) missense probably damaging 1.00
R5621:Zfp292 UTSW 4 34,811,703 (GRCm39) missense probably damaging 0.98
R5770:Zfp292 UTSW 4 34,806,747 (GRCm39) missense probably damaging 1.00
R5900:Zfp292 UTSW 4 34,805,125 (GRCm39) missense probably damaging 1.00
R5905:Zfp292 UTSW 4 34,819,549 (GRCm39) missense probably damaging 1.00
R5994:Zfp292 UTSW 4 34,805,464 (GRCm39) missense possibly damaging 0.87
R6028:Zfp292 UTSW 4 34,819,549 (GRCm39) missense probably damaging 1.00
R6056:Zfp292 UTSW 4 34,809,784 (GRCm39) missense probably damaging 1.00
R6093:Zfp292 UTSW 4 34,811,902 (GRCm39) missense probably damaging 1.00
R6126:Zfp292 UTSW 4 34,808,497 (GRCm39) missense probably benign 0.13
R6209:Zfp292 UTSW 4 34,809,442 (GRCm39) missense probably benign 0.14
R6275:Zfp292 UTSW 4 34,808,883 (GRCm39) missense possibly damaging 0.93
R6523:Zfp292 UTSW 4 34,816,301 (GRCm39) missense probably benign 0.21
R6747:Zfp292 UTSW 4 34,806,894 (GRCm39) missense probably damaging 0.97
R6752:Zfp292 UTSW 4 34,808,593 (GRCm39) missense possibly damaging 0.86
R6967:Zfp292 UTSW 4 34,807,812 (GRCm39) missense probably damaging 1.00
R7038:Zfp292 UTSW 4 34,816,357 (GRCm39) missense probably damaging 1.00
R7056:Zfp292 UTSW 4 34,809,784 (GRCm39) missense probably damaging 1.00
R7088:Zfp292 UTSW 4 34,806,796 (GRCm39) missense probably damaging 1.00
R7158:Zfp292 UTSW 4 34,808,679 (GRCm39) missense probably benign
R7254:Zfp292 UTSW 4 34,819,476 (GRCm39) missense probably damaging 0.98
R7350:Zfp292 UTSW 4 34,806,839 (GRCm39) missense probably benign
R7378:Zfp292 UTSW 4 34,808,384 (GRCm39) missense probably benign 0.26
R7535:Zfp292 UTSW 4 34,811,487 (GRCm39) missense probably benign 0.28
R7589:Zfp292 UTSW 4 34,806,777 (GRCm39) missense probably damaging 1.00
R7816:Zfp292 UTSW 4 34,809,865 (GRCm39) missense probably benign 0.02
R7979:Zfp292 UTSW 4 34,809,198 (GRCm39) missense probably benign 0.02
R7997:Zfp292 UTSW 4 34,808,688 (GRCm39) missense probably damaging 0.96
R8129:Zfp292 UTSW 4 34,807,386 (GRCm39) missense probably damaging 1.00
R8211:Zfp292 UTSW 4 34,806,163 (GRCm39) missense probably benign 0.00
R8302:Zfp292 UTSW 4 34,810,893 (GRCm39) missense possibly damaging 0.64
R8500:Zfp292 UTSW 4 34,826,691 (GRCm39) critical splice donor site probably null
R8709:Zfp292 UTSW 4 34,805,982 (GRCm39) missense probably damaging 1.00
R8947:Zfp292 UTSW 4 34,811,835 (GRCm39) missense probably damaging 1.00
R9099:Zfp292 UTSW 4 34,809,228 (GRCm39) missense possibly damaging 0.53
R9190:Zfp292 UTSW 4 34,819,563 (GRCm39) missense probably damaging 1.00
R9256:Zfp292 UTSW 4 34,839,899 (GRCm39) missense probably benign 0.02
R9371:Zfp292 UTSW 4 34,810,800 (GRCm39) missense probably damaging 1.00
R9492:Zfp292 UTSW 4 34,810,794 (GRCm39) missense probably benign 0.12
R9574:Zfp292 UTSW 4 34,839,460 (GRCm39) missense probably damaging 1.00
V7580:Zfp292 UTSW 4 34,806,783 (GRCm39) missense possibly damaging 0.85
V7581:Zfp292 UTSW 4 34,806,783 (GRCm39) missense possibly damaging 0.85
V7582:Zfp292 UTSW 4 34,806,783 (GRCm39) missense possibly damaging 0.85
V7583:Zfp292 UTSW 4 34,806,783 (GRCm39) missense possibly damaging 0.85
Z1177:Zfp292 UTSW 4 34,811,058 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGAAACTGGATTCTTTTCCC -3'
(R):5'- AGAAATTCTAATCTCCGGGCACAC -3'

Sequencing Primer
(F):5'- GAAACTGGATTCTTTTCCCGTTTTTC -3'
(R):5'- TAATCTCCGGGCACACTGTCAG -3'
Posted On 2015-10-21