Incidental Mutation 'R4684:Htt'

• ID: 353503
• Institutional Source: Beutler Lab
• Gene Symbol: Htt
• Ensembl Gene: ENSMUSG00000029104
• Gene Name: huntingtin
• Synonyms: HD, Hdh, htt, huntingtin, IT15
• Essential gene?: Essential (E-score: 1.000)
• Stock #: R4684 (G1)
• Quality Score: 225
• Status: Not validated
• Chromosome: 5
• Chromosomal Location: 34761740-34912534 bp(+) (GRCm38)
• Type of Mutation: missense
• DNA Base Change (assembly): C to T at 34852765 bp (GRCm38)
• Zygosity: Heterozygous
• Amino Acid Change: Proline to Serine at position 1521 (P1521S)
• Ref Sequence: ENSEMBL: ENSMUSP00000078945
• Gene Model: predicted gene model for transcript(s): [ENSMUST00000080036]
• AlphaFold: no structure available at present
• Predicted Effect: probably damaging; Transcript: ENSMUST00000080036; AA Change: P1521S; PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
• SMART Domains: Protein: ENSMUSP00000078945; Gene: ENSMUSG00000029104; AA Change: P1521S

Domain	Start	End	E-Value	Type
low complexity region	18	65	N/A	INTRINSIC
SCOP:d1qgra_	92	370	1e-12	SMART
low complexity region	371	388	N/A	INTRINSIC
low complexity region	432	453	N/A	INTRINSIC
low complexity region	1150	1161	N/A	INTRINSIC
low complexity region	1423	1441	N/A	INTRINSIC
Pfam:DUF3652	1494	1534	9.3e-20	PFAM
low complexity region	1812	1822	N/A	INTRINSIC
Blast:GAF	1866	2040	1e-104	BLAST
low complexity region	2461	2472	N/A	INTRINSIC
low complexity region	2611	2621	N/A	INTRINSIC
low complexity region	2622	2635	N/A	INTRINSIC
low complexity region	2857	2872	N/A	INTRINSIC

• Coding Region Coverage:
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Huntingtin is a disease gene linked to Huntington's disease, a neurodegenerative disorder characterized by loss of striatal neurons. This is thought to be caused by an expanded, unstable trinucleotide repeat in the huntingtin gene, which translates as a polyglutamine repeat in the protein product. A fairly broad range of trinucleotide repeats (9-35) has been identified in normal controls, and repeat numbers in excess of 40 have been described as pathological. The huntingtin locus is large, spanning 180 kb and consisting of 67 exons. The huntingtin gene is widely expressed and is required for normal development. It is expressed as 2 alternatively polyadenylated forms displaying different relative abundance in various fetal and adult tissues. The larger transcript is approximately 13.7 kb and is expressed predominantly in adult and fetal brain whereas the smaller transcript of approximately 10.3 kb is more widely expressed. The genetic defect leading to Huntington's disease may not necessarily eliminate transcription, but may confer a new property on the mRNA or alter the function of the protein. One candidate is the huntingtin-associated protein-1, highly expressed in brain, which has increased affinity for huntingtin protein with expanded polyglutamine repeats. This gene contains an upstream open reading frame in the 5' UTR that inhibits expression of the huntingtin gene product through translational repression. [provided by RefSeq, Jul 2016] ; PHENOTYPE: Null mutants gastrulate abnormally and die in utero. Conditional mutants are small with progressive neurodegeneration. Knock-ins of 20-150 CAG repeat units variably mimic Huntington's with late-onset motor defects, reactive gliosis and neuronal inclusions. [provided by MGI curators]
• Posted On: 2015-10-21

Predicted Primers

PCR Primer
(F):5'- CACATGTGCTAAGCAGTTTACC -3'
(R):5'- CCATGCTGTGATGTGGGTATCC -3'

Sequencing Primer
(F):5'- ATGTGCTAAGCAGTTTACCTCCAATC -3'
(R):5'- ATGTGGGTATCCCTGTGCTTTCC -3'