Incidental Mutation 'R4684:Pilra'
ID353507
Institutional Source Beutler Lab
Gene Symbol Pilra
Ensembl Gene ENSMUSG00000046245
Gene Namepaired immunoglobin-like type 2 receptor alpha
SynonymsFDF03
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R4684 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location137821952-137836281 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 137835515 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 96 (I96M)
Ref Sequence ENSEMBL: ENSMUSP00000050313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058897] [ENSMUST00000110980] [ENSMUST00000197586] [ENSMUST00000199028]
Predicted Effect probably damaging
Transcript: ENSMUST00000058897
AA Change: I96M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000050313
Gene: ENSMUSG00000046245
AA Change: I96M

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Blast:IG 45 155 3e-69 BLAST
low complexity region 156 176 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110980
AA Change: I93M

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106608
Gene: ENSMUSG00000046245
AA Change: I93M

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Blast:IG 42 152 1e-68 BLAST
low complexity region 153 173 N/A INTRINSIC
transmembrane domain 194 216 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130460
Predicted Effect probably damaging
Transcript: ENSMUST00000197586
AA Change: I93M

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142631
Gene: ENSMUSG00000046245
AA Change: I93M

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Blast:IG 42 94 8e-31 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000199028
SMART Domains Protein: ENSMUSP00000142391
Gene: ENSMUSG00000046245

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cell signaling pathways rely on a dynamic interaction between activating and inhibiting processes. SHP-1-mediated dephosphorylation of protein tyrosine residues is central to the regulation of several cell signaling pathways. Two types of inhibitory receptor superfamily members are immunoreceptor tyrosine-based inhibitory motif (ITIM)-bearing receptors and their non-ITIM-bearing, activating counterparts. Control of cell signaling via SHP-1 is thought to occur through a balance between PILRalpha-mediated inhibition and PILRbeta-mediated activation. These paired immunoglobulin-like receptor genes are located in a tandem head-to-tail orientation on chromosome 7. This particular gene encodes the ITIM-bearing member of the receptor pair, which functions in the inhibitory role. Alternative splicing has been observed at this locus and three variants, each encoding a distinct isoform, are described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased increased alanine transferase, blood urea nitrogen, lactate dehydrogenase, neutrophils and mortality and altered liver morphology (massive hemorrhage, disorganized hepatic cords and karyolysis of hepatocytes) following treatment with LPS. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310039H08Rik T C 17: 46,772,946 V45A probably benign Het
4921509C19Rik A G 2: 151,471,871 I629T unknown Het
4933402N03Rik T C 7: 131,138,684 R268G probably damaging Het
Abca13 A T 11: 9,434,193 R3882* probably null Het
Adamts3 T G 5: 89,703,007 T558P probably damaging Het
Ano2 A G 6: 125,790,341 N214S probably benign Het
Arhgef4 A T 1: 34,811,785 probably null Het
Boc C T 16: 44,500,380 A306T probably benign Het
Capn10 T C 1: 92,943,781 F367S probably damaging Het
Ccdc6 T C 10: 70,189,256 probably benign Het
Cobll1 G T 2: 65,099,028 S688R possibly damaging Het
Cpxm2 G T 7: 132,049,038 P631Q possibly damaging Het
Cyp2c68 A G 19: 39,699,335 V406A possibly damaging Het
Cyp4a30b T A 4: 115,455,003 Y118N probably damaging Het
Dgki A T 6: 37,299,846 probably benign Het
Disp2 A G 2: 118,792,756 N1323S probably damaging Het
Dock1 T A 7: 134,724,409 Y42* probably null Het
Eps8l1 C A 7: 4,473,945 P471Q probably damaging Het
Fam20a A C 11: 109,721,687 L10R unknown Het
Fpr-rs4 T A 17: 18,022,184 I151K probably damaging Het
Gga1 C A 15: 78,885,309 P161T probably damaging Het
Gm8909 A T 17: 36,165,858 H241Q possibly damaging Het
Gm9923 T A 10: 72,309,476 Y52* probably null Het
Gucy2g A G 19: 55,206,256 F910L probably damaging Het
Helz T C 11: 107,649,145 V315A probably damaging Het
Hk2 T C 6: 82,739,648 Y301C probably damaging Het
Htt C T 5: 34,852,765 P1521S probably damaging Het
Iah1 T C 12: 21,316,433 M1T probably null Het
Ik T C 18: 36,752,414 S287P probably damaging Het
Itga1 T A 13: 115,049,370 D32V probably damaging Het
Itpr2 A G 6: 146,373,173 F837S probably damaging Het
Klk14 A G 7: 43,691,968 I15V probably benign Het
Kng2 T C 16: 22,987,641 I603V possibly damaging Het
Lama1 T C 17: 67,773,778 I1267T possibly damaging Het
Lrp1b A C 2: 40,922,304 L2430V probably benign Het
Lrrn3 T G 12: 41,454,244 K25Q possibly damaging Het
Lta4h T A 10: 93,468,816 N233K probably benign Het
Mapk13 T C 17: 28,770,049 I53T probably damaging Het
Mdn1 T C 4: 32,666,430 F123L probably damaging Het
Mettl7b G T 10: 128,960,702 C79* probably null Het
Myh4 G C 11: 67,245,811 D472H probably damaging Het
Nipa2 A T 7: 55,935,826 N121K probably benign Het
Nostrin C T 2: 69,183,924 T408M probably benign Het
Olfr347 A G 2: 36,734,674 M118V probably damaging Het
Olfr725 T C 14: 50,034,830 D191G probably damaging Het
Oosp2 C T 19: 11,649,653 R102H probably damaging Het
Osgin2 T A 4: 16,001,946 I202L probably benign Het
Pbld2 C A 10: 63,057,697 R271S probably damaging Het
Pex6 C T 17: 46,712,101 T201I probably benign Het
Pllp T A 8: 94,677,278 D47V possibly damaging Het
Plxna2 A G 1: 194,762,594 S765G probably benign Het
Prkca A T 11: 107,961,608 Y100N probably damaging Het
Prkg1 T A 19: 31,664,179 K35* probably null Het
Psmc2 A G 5: 21,803,265 D389G possibly damaging Het
Rnf213 A G 11: 119,441,125 T2387A probably damaging Het
Ros1 T C 10: 52,129,096 N914S probably damaging Het
Ruvbl1 C A 6: 88,491,599 T367K probably benign Het
Scube2 C T 7: 109,810,713 R525H probably damaging Het
Sec14l4 T C 11: 4,035,200 probably null Het
Secisbp2l T C 2: 125,745,942 D751G probably damaging Het
Setd3 T C 12: 108,108,690 D402G probably benign Het
Slc15a2 T A 16: 36,757,849 K359N probably damaging Het
Slc25a21 A G 12: 57,196,936 S2P probably benign Het
Slfn8 A T 11: 83,017,506 H70Q probably benign Het
Spef2 T C 15: 9,647,490 I944V probably benign Het
Spg11 A G 2: 122,065,076 F1887S probably damaging Het
Sptbn4 T C 7: 27,364,419 E879G probably damaging Het
Sptbn4 A T 7: 27,366,735 D649E possibly damaging Het
Stx5a C A 19: 8,743,361 R121S probably damaging Het
Tbcd T C 11: 121,493,771 L26P probably damaging Het
Tecpr1 T C 5: 144,207,437 D649G probably benign Het
Tfam A G 10: 71,237,847 S32P probably benign Het
Trmt44 C T 5: 35,558,043 R642H probably benign Het
Trpm3 G A 19: 22,987,781 A1547T probably benign Het
Ttll6 T C 11: 96,153,177 V519A probably benign Het
Umodl1 T C 17: 30,998,114 F1107L probably benign Het
Usp5 A T 6: 124,817,956 V677E probably damaging Het
Utp20 A T 10: 88,807,445 L605* probably null Het
Utrn T C 10: 12,745,240 D229G probably damaging Het
Uty A T Y: 1,176,502 L178* probably null Het
Vmn2r88 A T 14: 51,413,334 D168V possibly damaging Het
Vps13b T C 15: 35,646,178 V1476A probably damaging Het
Vps13b C T 15: 35,841,341 H2506Y probably benign Het
Vps13b C A 15: 35,879,821 T3014K probably benign Het
Vps37c T C 19: 10,712,768 V198A probably benign Het
Zfc3h1 T C 10: 115,423,385 Y1621H probably benign Het
Zfp251 T C 15: 76,854,407 D162G possibly damaging Het
Zfp292 T C 4: 34,807,078 T1994A probably benign Het
Zfp791 A G 8: 85,110,930 Y102H probably benign Het
Other mutations in Pilra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01610:Pilra APN 5 137835541 missense probably damaging 1.00
IGL02331:Pilra APN 5 137835655 nonsense probably null
IGL02815:Pilra APN 5 137831305 missense probably benign 0.00
IGL03067:Pilra APN 5 137823581 missense probably damaging 0.99
R0032:Pilra UTSW 5 137831265 missense probably damaging 1.00
R0032:Pilra UTSW 5 137831265 missense probably damaging 1.00
R2851:Pilra UTSW 5 137836080 missense probably benign 0.03
R2852:Pilra UTSW 5 137836080 missense probably benign 0.03
R4250:Pilra UTSW 5 137823552 missense probably benign 0.27
R4359:Pilra UTSW 5 137831314 missense probably benign 0.00
R4655:Pilra UTSW 5 137835326 splice site probably null
R4744:Pilra UTSW 5 137835507 unclassified probably null
R5001:Pilra UTSW 5 137835515 missense probably damaging 1.00
R5072:Pilra UTSW 5 137835412 missense probably damaging 0.97
R5073:Pilra UTSW 5 137835412 missense probably damaging 0.97
R5074:Pilra UTSW 5 137835412 missense probably damaging 0.97
R5337:Pilra UTSW 5 137835770 intron probably benign
R5349:Pilra UTSW 5 137831226 missense probably damaging 0.98
R5479:Pilra UTSW 5 137836056 missense possibly damaging 0.48
R6233:Pilra UTSW 5 137823501 missense possibly damaging 0.66
R6542:Pilra UTSW 5 137821975 unclassified probably null
R7103:Pilra UTSW 5 137831226 missense possibly damaging 0.80
R7714:Pilra UTSW 5 137835417 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GTTGGGTCCCAGGAATTGACTG -3'
(R):5'- TGCAGTGGCTTCAGAGTCTC -3'

Sequencing Primer
(F):5'- TTGACTGCCAAAACTGTATGCC -3'
(R):5'- TTCCCAGGAAATTCAGAAAGATCC -3'
Posted On2015-10-21