Incidental Mutation 'R4684:Ruvbl1'
ID353511
Institutional Source Beutler Lab
Gene Symbol Ruvbl1
Ensembl Gene ENSMUSG00000030079
Gene NameRuvB-like protein 1
SynonymsTip49a, 2510009G06Rik, Pontin52
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R4684 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location88465409-88497572 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 88491599 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 367 (T367K)
Ref Sequence ENSEMBL: ENSMUSP00000032165 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032165]
Predicted Effect probably benign
Transcript: ENSMUST00000032165
AA Change: T367K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000032165
Gene: ENSMUSG00000030079
AA Change: T367K

DomainStartEndE-ValueType
AAA 62 365 1.51e-11 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has both DNA-dependent ATPase and DNA helicase activities and belongs to the ATPases associated with diverse cellular activities (AAA+) protein family. The encoded protein associates with several multisubunit transcriptional complexes and with protein complexes involved in both ATP-dependent remodeling and histone modification. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a null allele show impaired proliferation of the pluripotent inner mass cells and embryonic lethality before implantation. Conditional ablation of this gene in hematopoietic tissues leads to bone marrow failure involving apoptotic loss of hematopoietic stem cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310039H08Rik T C 17: 46,772,946 V45A probably benign Het
4921509C19Rik A G 2: 151,471,871 I629T unknown Het
4933402N03Rik T C 7: 131,138,684 R268G probably damaging Het
Abca13 A T 11: 9,434,193 R3882* probably null Het
Adamts3 T G 5: 89,703,007 T558P probably damaging Het
Ano2 A G 6: 125,790,341 N214S probably benign Het
Arhgef4 A T 1: 34,811,785 probably null Het
Boc C T 16: 44,500,380 A306T probably benign Het
Capn10 T C 1: 92,943,781 F367S probably damaging Het
Ccdc6 T C 10: 70,189,256 probably benign Het
Cobll1 G T 2: 65,099,028 S688R possibly damaging Het
Cpxm2 G T 7: 132,049,038 P631Q possibly damaging Het
Cyp2c68 A G 19: 39,699,335 V406A possibly damaging Het
Cyp4a30b T A 4: 115,455,003 Y118N probably damaging Het
Dgki A T 6: 37,299,846 probably benign Het
Disp2 A G 2: 118,792,756 N1323S probably damaging Het
Dock1 T A 7: 134,724,409 Y42* probably null Het
Eps8l1 C A 7: 4,473,945 P471Q probably damaging Het
Fam20a A C 11: 109,721,687 L10R unknown Het
Fpr-rs4 T A 17: 18,022,184 I151K probably damaging Het
Gga1 C A 15: 78,885,309 P161T probably damaging Het
Gm8909 A T 17: 36,165,858 H241Q possibly damaging Het
Gm9923 T A 10: 72,309,476 Y52* probably null Het
Gucy2g A G 19: 55,206,256 F910L probably damaging Het
Helz T C 11: 107,649,145 V315A probably damaging Het
Hk2 T C 6: 82,739,648 Y301C probably damaging Het
Htt C T 5: 34,852,765 P1521S probably damaging Het
Iah1 T C 12: 21,316,433 M1T probably null Het
Ik T C 18: 36,752,414 S287P probably damaging Het
Itga1 T A 13: 115,049,370 D32V probably damaging Het
Itpr2 A G 6: 146,373,173 F837S probably damaging Het
Klk14 A G 7: 43,691,968 I15V probably benign Het
Kng2 T C 16: 22,987,641 I603V possibly damaging Het
Lama1 T C 17: 67,773,778 I1267T possibly damaging Het
Lrp1b A C 2: 40,922,304 L2430V probably benign Het
Lrrn3 T G 12: 41,454,244 K25Q possibly damaging Het
Lta4h T A 10: 93,468,816 N233K probably benign Het
Mapk13 T C 17: 28,770,049 I53T probably damaging Het
Mdn1 T C 4: 32,666,430 F123L probably damaging Het
Mettl7b G T 10: 128,960,702 C79* probably null Het
Myh4 G C 11: 67,245,811 D472H probably damaging Het
Nipa2 A T 7: 55,935,826 N121K probably benign Het
Nostrin C T 2: 69,183,924 T408M probably benign Het
Olfr347 A G 2: 36,734,674 M118V probably damaging Het
Olfr725 T C 14: 50,034,830 D191G probably damaging Het
Oosp2 C T 19: 11,649,653 R102H probably damaging Het
Osgin2 T A 4: 16,001,946 I202L probably benign Het
Pbld2 C A 10: 63,057,697 R271S probably damaging Het
Pex6 C T 17: 46,712,101 T201I probably benign Het
Pilra T C 5: 137,835,515 I96M probably damaging Het
Pllp T A 8: 94,677,278 D47V possibly damaging Het
Plxna2 A G 1: 194,762,594 S765G probably benign Het
Prkca A T 11: 107,961,608 Y100N probably damaging Het
Prkg1 T A 19: 31,664,179 K35* probably null Het
Psmc2 A G 5: 21,803,265 D389G possibly damaging Het
Rnf213 A G 11: 119,441,125 T2387A probably damaging Het
Ros1 T C 10: 52,129,096 N914S probably damaging Het
Scube2 C T 7: 109,810,713 R525H probably damaging Het
Sec14l4 T C 11: 4,035,200 probably null Het
Secisbp2l T C 2: 125,745,942 D751G probably damaging Het
Setd3 T C 12: 108,108,690 D402G probably benign Het
Slc15a2 T A 16: 36,757,849 K359N probably damaging Het
Slc25a21 A G 12: 57,196,936 S2P probably benign Het
Slfn8 A T 11: 83,017,506 H70Q probably benign Het
Spef2 T C 15: 9,647,490 I944V probably benign Het
Spg11 A G 2: 122,065,076 F1887S probably damaging Het
Sptbn4 T C 7: 27,364,419 E879G probably damaging Het
Sptbn4 A T 7: 27,366,735 D649E possibly damaging Het
Stx5a C A 19: 8,743,361 R121S probably damaging Het
Tbcd T C 11: 121,493,771 L26P probably damaging Het
Tecpr1 T C 5: 144,207,437 D649G probably benign Het
Tfam A G 10: 71,237,847 S32P probably benign Het
Trmt44 C T 5: 35,558,043 R642H probably benign Het
Trpm3 G A 19: 22,987,781 A1547T probably benign Het
Ttll6 T C 11: 96,153,177 V519A probably benign Het
Umodl1 T C 17: 30,998,114 F1107L probably benign Het
Usp5 A T 6: 124,817,956 V677E probably damaging Het
Utp20 A T 10: 88,807,445 L605* probably null Het
Utrn T C 10: 12,745,240 D229G probably damaging Het
Uty A T Y: 1,176,502 L178* probably null Het
Vmn2r88 A T 14: 51,413,334 D168V possibly damaging Het
Vps13b T C 15: 35,646,178 V1476A probably damaging Het
Vps13b C T 15: 35,841,341 H2506Y probably benign Het
Vps13b C A 15: 35,879,821 T3014K probably benign Het
Vps37c T C 19: 10,712,768 V198A probably benign Het
Zfc3h1 T C 10: 115,423,385 Y1621H probably benign Het
Zfp251 T C 15: 76,854,407 D162G possibly damaging Het
Zfp292 T C 4: 34,807,078 T1994A probably benign Het
Zfp791 A G 8: 85,110,930 Y102H probably benign Het
Other mutations in Ruvbl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Ruvbl1 APN 6 88484403 unclassified probably benign
IGL00473:Ruvbl1 APN 6 88491568 missense probably damaging 1.00
IGL01768:Ruvbl1 APN 6 88497271 missense probably benign
IGL03354:Ruvbl1 APN 6 88479215 nonsense probably null
R0106:Ruvbl1 UTSW 6 88473200 missense probably damaging 1.00
R0106:Ruvbl1 UTSW 6 88473200 missense probably damaging 1.00
R0145:Ruvbl1 UTSW 6 88484459 missense possibly damaging 0.90
R0676:Ruvbl1 UTSW 6 88473200 missense probably damaging 1.00
R1448:Ruvbl1 UTSW 6 88467569 missense probably benign 0.05
R1561:Ruvbl1 UTSW 6 88479154 missense probably damaging 1.00
R1574:Ruvbl1 UTSW 6 88479154 missense probably damaging 1.00
R1623:Ruvbl1 UTSW 6 88485770 missense probably damaging 1.00
R2113:Ruvbl1 UTSW 6 88483021 missense probably damaging 0.99
R2372:Ruvbl1 UTSW 6 88485797 missense possibly damaging 0.53
R2397:Ruvbl1 UTSW 6 88465552 missense possibly damaging 0.71
R2894:Ruvbl1 UTSW 6 88479132 missense possibly damaging 0.87
R4037:Ruvbl1 UTSW 6 88473135 missense probably damaging 1.00
R4604:Ruvbl1 UTSW 6 88485905 missense probably benign
R4714:Ruvbl1 UTSW 6 88484430 missense possibly damaging 0.61
R4835:Ruvbl1 UTSW 6 88497229 missense possibly damaging 0.69
R4939:Ruvbl1 UTSW 6 88483039 unclassified probably null
R5114:Ruvbl1 UTSW 6 88497290 missense probably benign 0.41
R5126:Ruvbl1 UTSW 6 88485901 missense probably benign 0.13
R5296:Ruvbl1 UTSW 6 88485908 missense probably damaging 0.99
R5507:Ruvbl1 UTSW 6 88467600 missense probably benign 0.00
R5559:Ruvbl1 UTSW 6 88473096 missense possibly damaging 0.90
R5819:Ruvbl1 UTSW 6 88483115 splice site probably null
R6048:Ruvbl1 UTSW 6 88482991 missense possibly damaging 0.90
R6155:Ruvbl1 UTSW 6 88479125 critical splice acceptor site probably null
R6564:Ruvbl1 UTSW 6 88479226 missense possibly damaging 0.93
R6704:Ruvbl1 UTSW 6 88479205 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TGATACTCAGGGATGCTAGCTAC -3'
(R):5'- ATAGCTGGGCAAGACCATGG -3'

Sequencing Primer
(F):5'- AGGGATGCTAGCTACCTACTTGTAC -3'
(R):5'- GGCAAGACCATGGGCTCTAATC -3'
Posted On2015-10-21