Mutagenetix > Incidental Mutation

Incidental Mutation 'R4684:Sptbn4'

353517

Institutional Source

Beutler Lab

Gene Symbol

Sptbn4

Ensembl Gene

ENSMUSG00000011751

Gene Name

spectrin beta, non-erythrocytic 4

Synonyms

ROSA62, 1700022P15Rik, dyn, neuroaxonal dystrophy, 5830426A08Rik, nmf261, SpbIV, Spnb4

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.382) question?

Stock #

R4684 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

27356383-27447686 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 27366735 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 649 (D649E)

Ref Sequence

ENSEMBL: ENSMUSP00000104001 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000011895] [ENSMUST00000108362] [ENSMUST00000108363] [ENSMUST00000108364] [ENSMUST00000172269]

AlphaFold

E9PX29

Predicted Effect

possibly damaging
Transcript: ENSMUST00000011895
AA Change: D1969E

PolyPhen 2 Score 0.486 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000011895
Gene: ENSMUSG00000011751
AA Change: D1969E

Domain	Start	End	E-Value	Type
low complexity region	39	45	N/A	INTRINSIC
CH	64	164	8.03e-24	SMART
CH	183	281	7.38e-23	SMART
Pfam:Spectrin	310	420	1.4e-10	PFAM
SPEC	433	533	5.22e-26	SMART
SPEC	539	642	7.62e-19	SMART
SPEC	648	766	1.31e-8	SMART
SPEC	772	874	2.94e-11	SMART
SPEC	880	980	1.49e-21	SMART
SPEC	986	1081	1.65e0	SMART
SPEC	1087	1192	2.82e-13	SMART
SPEC	1198	1298	6.59e-14	SMART
SPEC	1304	1403	4.08e-19	SMART
SPEC	1409	1508	5.92e-7	SMART
SPEC	1514	1614	2.45e-22	SMART
SPEC	1620	1720	1.45e-24	SMART
SPEC	1726	1827	1.86e-22	SMART
SPEC	1833	1935	9.54e-11	SMART
SPEC	1941	2041	1.35e-19	SMART
SPEC	2047	2297	1.06e-8	SMART
low complexity region	2358	2412	N/A	INTRINSIC
PH	2416	2526	1.54e-14	SMART
low complexity region	2549	2560	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000108362
AA Change: D649E

PolyPhen 2 Score 0.595 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000103999
Gene: ENSMUSG00000011751
AA Change: D649E

Domain	Start	End	E-Value	Type
SPEC	1	83	9.7e-3	SMART
SPEC	89	188	5.92e-7	SMART
SPEC	194	294	2.45e-22	SMART
SPEC	300	400	1.45e-24	SMART
SPEC	406	507	1.86e-22	SMART
SPEC	513	615	9.54e-11	SMART
SPEC	621	721	1.35e-19	SMART
SPEC	727	977	1.06e-8	SMART
low complexity region	1038	1092	N/A	INTRINSIC
PH	1096	1206	1.54e-14	SMART
low complexity region	1229	1240	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000108363
AA Change: D649E

PolyPhen 2 Score 0.595 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000104000
Gene: ENSMUSG00000011751
AA Change: D649E

Domain	Start	End	E-Value	Type
SPEC	1	83	9.7e-3	SMART
SPEC	89	188	5.92e-7	SMART
SPEC	194	294	2.45e-22	SMART
SPEC	300	400	1.45e-24	SMART
SPEC	406	507	1.86e-22	SMART
SPEC	513	615	9.54e-11	SMART
SPEC	621	721	1.35e-19	SMART
SPEC	727	977	1.06e-8	SMART
low complexity region	1038	1092	N/A	INTRINSIC
PH	1096	1206	1.54e-14	SMART
low complexity region	1229	1240	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000108364
AA Change: D649E

PolyPhen 2 Score 0.595 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000104001
Gene: ENSMUSG00000011751
AA Change: D649E

Domain	Start	End	E-Value	Type
SPEC	1	83	9.7e-3	SMART
SPEC	89	188	5.92e-7	SMART
SPEC	194	294	2.45e-22	SMART
SPEC	300	400	1.45e-24	SMART
SPEC	406	507	1.86e-22	SMART
SPEC	513	615	9.54e-11	SMART
SPEC	621	721	1.35e-19	SMART
SPEC	727	977	1.06e-8	SMART
low complexity region	1038	1092	N/A	INTRINSIC
PH	1096	1206	1.54e-14	SMART
low complexity region	1229	1240	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000172269
AA Change: D1964E

PolyPhen 2 Score 0.486 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000132807
Gene: ENSMUSG00000011751
AA Change: D1964E

Domain	Start	End	E-Value	Type
low complexity region	39	45	N/A	INTRINSIC
CH	64	164	8.03e-24	SMART
CH	183	281	7.38e-23	SMART
Pfam:Spectrin	310	420	1.9e-10	PFAM
SPEC	433	533	5.22e-26	SMART
SPEC	539	637	3.45e-17	SMART
SPEC	643	761	1.31e-8	SMART
SPEC	767	869	2.94e-11	SMART
SPEC	875	975	1.49e-21	SMART
SPEC	981	1076	1.65e0	SMART
SPEC	1082	1187	2.82e-13	SMART
SPEC	1193	1293	6.59e-14	SMART
SPEC	1299	1398	4.08e-19	SMART
SPEC	1404	1503	5.92e-7	SMART
SPEC	1509	1609	2.45e-22	SMART
SPEC	1615	1715	1.45e-24	SMART
SPEC	1721	1822	1.86e-22	SMART
SPEC	1828	1930	9.54e-11	SMART
SPEC	1936	2036	1.35e-19	SMART
SPEC	2042	2292	1.06e-8	SMART
low complexity region	2352	2406	N/A	INTRINSIC
PH	2410	2520	1.54e-14	SMART
low complexity region	2543	2554	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is composed of two antiparallel dimers of alpha- and beta- subunits. This gene is one member of a family of beta-spectrin genes. The encoded protein localizes to the nuclear matrix, PML nuclear bodies, and cytoplasmic vesicles. A highly similar gene in the mouse is required for localization of specific membrane proteins in polarized regions of neurons. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit tremors, progressive ataxia with hind limb paralysis, central deafness, reduced body weight, and shortened lifespan. Males are sterile, but females may breed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310039H08Rik	T	C	17: 46,772,946	V45A	probably benign	Het
4921509C19Rik	A	G	2: 151,471,871	I629T	unknown	Het
4933402N03Rik	T	C	7: 131,138,684	R268G	probably damaging	Het
Abca13	A	T	11: 9,434,193	R3882*	probably null	Het
Adamts3	T	G	5: 89,703,007	T558P	probably damaging	Het
Ano2	A	G	6: 125,790,341	N214S	probably benign	Het
Arhgef4	A	T	1: 34,811,785		probably null	Het
Boc	C	T	16: 44,500,380	A306T	probably benign	Het
Capn10	T	C	1: 92,943,781	F367S	probably damaging	Het
Ccdc6	T	C	10: 70,189,256		probably benign	Het
Cobll1	G	T	2: 65,099,028	S688R	possibly damaging	Het
Cpxm2	G	T	7: 132,049,038	P631Q	possibly damaging	Het
Cyp2c68	A	G	19: 39,699,335	V406A	possibly damaging	Het
Cyp4a30b	T	A	4: 115,455,003	Y118N	probably damaging	Het
Dgki	A	T	6: 37,299,846		probably benign	Het
Disp2	A	G	2: 118,792,756	N1323S	probably damaging	Het
Dock1	T	A	7: 134,724,409	Y42*	probably null	Het
Eps8l1	C	A	7: 4,473,945	P471Q	probably damaging	Het
Fam20a	A	C	11: 109,721,687	L10R	unknown	Het
Fpr-rs4	T	A	17: 18,022,184	I151K	probably damaging	Het
Gga1	C	A	15: 78,885,309	P161T	probably damaging	Het
Gm8909	A	T	17: 36,165,858	H241Q	possibly damaging	Het
Gm9923	T	A	10: 72,309,476	Y52*	probably null	Het
Gucy2g	A	G	19: 55,206,256	F910L	probably damaging	Het
Helz	T	C	11: 107,649,145	V315A	probably damaging	Het
Hk2	T	C	6: 82,739,648	Y301C	probably damaging	Het
Htt	C	T	5: 34,852,765	P1521S	probably damaging	Het
Iah1	T	C	12: 21,316,433	M1T	probably null	Het
Ik	T	C	18: 36,752,414	S287P	probably damaging	Het
Itga1	T	A	13: 115,049,370	D32V	probably damaging	Het
Itpr2	A	G	6: 146,373,173	F837S	probably damaging	Het
Klk14	A	G	7: 43,691,968	I15V	probably benign	Het
Kng2	T	C	16: 22,987,641	I603V	possibly damaging	Het
Lama1	T	C	17: 67,773,778	I1267T	possibly damaging	Het
Lrp1b	A	C	2: 40,922,304	L2430V	probably benign	Het
Lrrn3	T	G	12: 41,454,244	K25Q	possibly damaging	Het
Lta4h	T	A	10: 93,468,816	N233K	probably benign	Het
Mapk13	T	C	17: 28,770,049	I53T	probably damaging	Het
Mdn1	T	C	4: 32,666,430	F123L	probably damaging	Het
Mettl7b	G	T	10: 128,960,702	C79*	probably null	Het
Myh4	G	C	11: 67,245,811	D472H	probably damaging	Het
Nipa2	A	T	7: 55,935,826	N121K	probably benign	Het
Nostrin	C	T	2: 69,183,924	T408M	probably benign	Het
Olfr347	A	G	2: 36,734,674	M118V	probably damaging	Het
Olfr725	T	C	14: 50,034,830	D191G	probably damaging	Het
Oosp2	C	T	19: 11,649,653	R102H	probably damaging	Het
Osgin2	T	A	4: 16,001,946	I202L	probably benign	Het
Pbld2	C	A	10: 63,057,697	R271S	probably damaging	Het
Pex6	C	T	17: 46,712,101	T201I	probably benign	Het
Pilra	T	C	5: 137,835,515	I96M	probably damaging	Het
Pllp	T	A	8: 94,677,278	D47V	possibly damaging	Het
Plxna2	A	G	1: 194,762,594	S765G	probably benign	Het
Prkca	A	T	11: 107,961,608	Y100N	probably damaging	Het
Prkg1	T	A	19: 31,664,179	K35*	probably null	Het
Psmc2	A	G	5: 21,803,265	D389G	possibly damaging	Het
Rnf213	A	G	11: 119,441,125	T2387A	probably damaging	Het
Ros1	T	C	10: 52,129,096	N914S	probably damaging	Het
Ruvbl1	C	A	6: 88,491,599	T367K	probably benign	Het
Scube2	C	T	7: 109,810,713	R525H	probably damaging	Het
Sec14l4	T	C	11: 4,035,200		probably null	Het
Secisbp2l	T	C	2: 125,745,942	D751G	probably damaging	Het
Setd3	T	C	12: 108,108,690	D402G	probably benign	Het
Slc15a2	T	A	16: 36,757,849	K359N	probably damaging	Het
Slc25a21	A	G	12: 57,196,936	S2P	probably benign	Het
Slfn8	A	T	11: 83,017,506	H70Q	probably benign	Het
Spef2	T	C	15: 9,647,490	I944V	probably benign	Het
Spg11	A	G	2: 122,065,076	F1887S	probably damaging	Het
Stx5a	C	A	19: 8,743,361	R121S	probably damaging	Het
Tbcd	T	C	11: 121,493,771	L26P	probably damaging	Het
Tecpr1	T	C	5: 144,207,437	D649G	probably benign	Het
Tfam	A	G	10: 71,237,847	S32P	probably benign	Het
Trmt44	C	T	5: 35,558,043	R642H	probably benign	Het
Trpm3	G	A	19: 22,987,781	A1547T	probably benign	Het
Ttll6	T	C	11: 96,153,177	V519A	probably benign	Het
Umodl1	T	C	17: 30,998,114	F1107L	probably benign	Het
Usp5	A	T	6: 124,817,956	V677E	probably damaging	Het
Utp20	A	T	10: 88,807,445	L605*	probably null	Het
Utrn	T	C	10: 12,745,240	D229G	probably damaging	Het
Uty	A	T	Y: 1,176,502	L178*	probably null	Het
Vmn2r88	A	T	14: 51,413,334	D168V	possibly damaging	Het
Vps13b	T	C	15: 35,646,178	V1476A	probably damaging	Het
Vps13b	C	T	15: 35,841,341	H2506Y	probably benign	Het
Vps13b	C	A	15: 35,879,821	T3014K	probably benign	Het
Vps37c	T	C	19: 10,712,768	V198A	probably benign	Het
Zfc3h1	T	C	10: 115,423,385	Y1621H	probably benign	Het
Zfp251	T	C	15: 76,854,407	D162G	possibly damaging	Het
Zfp292	T	C	4: 34,807,078	T1994A	probably benign	Het
Zfp791	A	G	8: 85,110,930	Y102H	probably benign	Het

Other mutations in Sptbn4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00096:Sptbn4	APN	7	27369434	missense	probably damaging	1.00
IGL00468:Sptbn4	APN	7	27417965	missense	probably damaging	1.00
IGL01396:Sptbn4	APN	7	27414771	missense	probably benign	0.06
IGL01700:Sptbn4	APN	7	27404268	missense	probably damaging	1.00
IGL01878:Sptbn4	APN	7	27364146	missense	probably damaging	0.99
IGL02066:Sptbn4	APN	7	27364515	missense	possibly damaging	0.68
IGL02116:Sptbn4	APN	7	27364357	missense	probably benign
IGL02226:Sptbn4	APN	7	27365707	missense	probably damaging	1.00
IGL02333:Sptbn4	APN	7	27364299	missense	probably damaging	1.00
IGL02337:Sptbn4	APN	7	27428247	missense	probably benign	0.03
IGL02451:Sptbn4	APN	7	27365589	missense	probably null	0.15
IGL02487:Sptbn4	APN	7	27419097	missense	probably damaging	1.00
IGL02530:Sptbn4	APN	7	27391551	missense	probably damaging	1.00
IGL02724:Sptbn4	APN	7	27367679	missense	probably damaging	1.00
IGL02850:Sptbn4	APN	7	27426833	missense	possibly damaging	0.95
IGL02851:Sptbn4	APN	7	27426833	missense	possibly damaging	0.95
IGL02869:Sptbn4	APN	7	27394148	splice site	probably benign
IGL02961:Sptbn4	APN	7	27397967	missense	probably damaging	1.00
ANU22:Sptbn4	UTSW	7	27357387	nonsense	probably null
R0194:Sptbn4	UTSW	7	27404911	missense	probably benign	0.00
R0328:Sptbn4	UTSW	7	27364170	missense	probably damaging	1.00
R0379:Sptbn4	UTSW	7	27359736	splice site	probably benign
R0510:Sptbn4	UTSW	7	27361566	critical splice donor site	probably null
R0550:Sptbn4	UTSW	7	27364378	missense	probably benign	0.16
R0557:Sptbn4	UTSW	7	27408328	nonsense	probably null
R1336:Sptbn4	UTSW	7	27417963	missense	probably damaging	1.00
R1494:Sptbn4	UTSW	7	27434294	missense	probably damaging	1.00
R1630:Sptbn4	UTSW	7	27418739	missense	probably benign	0.09
R1803:Sptbn4	UTSW	7	27418583	missense	probably damaging	1.00
R1834:Sptbn4	UTSW	7	27366646	missense	probably null	0.96
R1906:Sptbn4	UTSW	7	27391431	critical splice donor site	probably null
R1924:Sptbn4	UTSW	7	27407138	missense	probably damaging	1.00
R1951:Sptbn4	UTSW	7	27366443	missense	possibly damaging	0.64
R1989:Sptbn4	UTSW	7	27367702	missense	probably damaging	1.00
R1990:Sptbn4	UTSW	7	27423810	missense	probably benign	0.19
R2005:Sptbn4	UTSW	7	27366419	nonsense	probably null
R2083:Sptbn4	UTSW	7	27428256	missense	probably benign	0.29
R2176:Sptbn4	UTSW	7	27364162	missense	probably benign	0.21
R2211:Sptbn4	UTSW	7	27367609	missense	probably damaging	1.00
R2262:Sptbn4	UTSW	7	27434357	missense	probably damaging	1.00
R2263:Sptbn4	UTSW	7	27434357	missense	probably damaging	1.00
R2374:Sptbn4	UTSW	7	27360092	missense	probably damaging	0.99
R2407:Sptbn4	UTSW	7	27418098	nonsense	probably null
R4115:Sptbn4	UTSW	7	27391570	missense	probably damaging	1.00
R4116:Sptbn4	UTSW	7	27391570	missense	probably damaging	1.00
R4392:Sptbn4	UTSW	7	27418471	missense	probably damaging	0.97
R4426:Sptbn4	UTSW	7	27423798	missense	probably damaging	1.00
R4535:Sptbn4	UTSW	7	27367702	missense	probably damaging	1.00
R4684:Sptbn4	UTSW	7	27364419	missense	probably damaging	0.96
R4707:Sptbn4	UTSW	7	27417006	missense	probably benign	0.12
R4876:Sptbn4	UTSW	7	27372152	missense	probably damaging	1.00
R5091:Sptbn4	UTSW	7	27369391	missense	probably damaging	1.00
R5371:Sptbn4	UTSW	7	27359741	critical splice donor site	probably null
R5790:Sptbn4	UTSW	7	27366428	missense	probably damaging	0.99
R5857:Sptbn4	UTSW	7	27418713	missense	possibly damaging	0.89
R5908:Sptbn4	UTSW	7	27404253	missense	probably benign	0.00
R5980:Sptbn4	UTSW	7	27372171	missense	probably damaging	1.00
R6005:Sptbn4	UTSW	7	27418599	missense	probably damaging	1.00
R6013:Sptbn4	UTSW	7	27364479	missense	probably damaging	0.99
R6037:Sptbn4	UTSW	7	27364170	missense	probably damaging	0.97
R6037:Sptbn4	UTSW	7	27364170	missense	probably damaging	0.97
R6129:Sptbn4	UTSW	7	27360088	missense	probably damaging	0.98
R6146:Sptbn4	UTSW	7	27364587	nonsense	probably null
R6762:Sptbn4	UTSW	7	27394208	missense	probably damaging	1.00
R6897:Sptbn4	UTSW	7	27371950	missense	possibly damaging	0.96
R7178:Sptbn4	UTSW	7	27418056	missense	probably damaging	1.00
R7212:Sptbn4	UTSW	7	27416785	missense	probably benign	0.44
R7465:Sptbn4	UTSW	7	27366689	missense	probably benign	0.00
R7471:Sptbn4	UTSW	7	27409014	missense	possibly damaging	0.64
R7510:Sptbn4	UTSW	7	27428268	missense	probably benign	0.13
R7527:Sptbn4	UTSW	7	27375590	missense	possibly damaging	0.94
R7528:Sptbn4	UTSW	7	27442535	missense	probably benign	0.00
R7572:Sptbn4	UTSW	7	27372272	missense	probably damaging	0.99
R7649:Sptbn4	UTSW	7	27361577	missense	possibly damaging	0.80
R7714:Sptbn4	UTSW	7	27364336	missense	probably benign	0.02
R7780:Sptbn4	UTSW	7	27361634	missense	possibly damaging	0.70
R7854:Sptbn4	UTSW	7	27362410	missense	probably benign
R8002:Sptbn4	UTSW	7	27417992	missense	possibly damaging	0.91
R8058:Sptbn4	UTSW	7	27364269	missense	possibly damaging	0.92
R8181:Sptbn4	UTSW	7	27375383	missense	possibly damaging	0.79
R8195:Sptbn4	UTSW	7	27408889	nonsense	probably null
R8353:Sptbn4	UTSW	7	27404238	missense	probably damaging	1.00
R8392:Sptbn4	UTSW	7	27372296	missense	probably damaging	1.00
R8453:Sptbn4	UTSW	7	27404238	missense	probably damaging	1.00
R8815:Sptbn4	UTSW	7	27407232	nonsense	probably null
R8818:Sptbn4	UTSW	7	27364167	missense	possibly damaging	0.71
R9171:Sptbn4	UTSW	7	27442419	missense	possibly damaging	0.95
R9259:Sptbn4	UTSW	7	27367699	missense	possibly damaging	0.74
R9477:Sptbn4	UTSW	7	27433199	missense	possibly damaging	0.79
R9564:Sptbn4	UTSW	7	27418079	missense	probably damaging	0.98
R9572:Sptbn4	UTSW	7	27366670	missense	probably benign	0.16
R9623:Sptbn4	UTSW	7	27408382	missense	probably damaging	1.00
R9715:Sptbn4	UTSW	7	27391575	missense	probably damaging	1.00
R9782:Sptbn4	UTSW	7	27408568	missense	probably benign	0.02
R9790:Sptbn4	UTSW	7	27372237	missense	probably damaging	0.99
R9791:Sptbn4	UTSW	7	27372237	missense	probably damaging	0.99
R9798:Sptbn4	UTSW	7	27357292	makesense	probably null
X0020:Sptbn4	UTSW	7	27402734	critical splice donor site	probably null
X0066:Sptbn4	UTSW	7	27357311	unclassified	probably benign
Z1176:Sptbn4	UTSW	7	27360025	missense	probably damaging	0.99
Z1177:Sptbn4	UTSW	7	27404582	missense	probably damaging	1.00
Z1177:Sptbn4	UTSW	7	27409102	missense	probably benign	0.41

Predicted Primers

PCR Primer
(F):5'- GGTGAGCTAGGTACCAGGTATG -3'
(R):5'- TCGGGTCACTGACTTAATGAAG -3'

Sequencing Primer
(F):5'- AGAGATGGACCTGCCCTCAC -3'
(R):5'- GGTCACTGACTTAATGAAGACCCTG -3'

Posted On

2015-10-21