Mutagenetix > Incidental Mutation

Incidental Mutation 'R4684:Sec14l4'

353537

Institutional Source

Beutler Lab

Gene Symbol

Sec14l4

Ensembl Gene

ENSMUSG00000019368

Gene Name

SEC14-like lipid binding 4

Synonyms

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4684 (G1)

Quality Score

205

Status

Not validated

Chromosome

Chromosomal Location

4031462-4048024 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 4035200 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000019512 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019512]

AlphaFold

Q8R0F9

Predicted Effect

probably null
Transcript: ENSMUST00000019512

SMART Domains

Protein: ENSMUSP00000019512
Gene: ENSMUSG00000019368

Domain	Start	End	E-Value	Type
CRAL_TRIO_N	34	59	1.89e-6	SMART
SEC14	76	246	7.7e-57	SMART
Blast:SEC14	257	338	2e-36	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125351

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126423

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129689

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131171

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136222

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137324

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to the protein encoded by the Saccharomyces cerevisiae SEC14 gene. The SEC14 protein is a phophatidylinositol transfer protein that is essential for biogenesis of Golgi-derived transport vesicles, and thus is required for the export of yeast secretory proteins from the Golgi complex. The specific function of this protein has not yet been determined. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2009]

Allele List at MGI

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310039H08Rik	T	C	17: 46,772,946	V45A	probably benign	Het
4921509C19Rik	A	G	2: 151,471,871	I629T	unknown	Het
4933402N03Rik	T	C	7: 131,138,684	R268G	probably damaging	Het
Abca13	A	T	11: 9,434,193	R3882*	probably null	Het
Adamts3	T	G	5: 89,703,007	T558P	probably damaging	Het
Ano2	A	G	6: 125,790,341	N214S	probably benign	Het
Arhgef4	A	T	1: 34,811,785		probably null	Het
Boc	C	T	16: 44,500,380	A306T	probably benign	Het
Capn10	T	C	1: 92,943,781	F367S	probably damaging	Het
Ccdc6	T	C	10: 70,189,256		probably benign	Het
Cobll1	G	T	2: 65,099,028	S688R	possibly damaging	Het
Cpxm2	G	T	7: 132,049,038	P631Q	possibly damaging	Het
Cyp2c68	A	G	19: 39,699,335	V406A	possibly damaging	Het
Cyp4a30b	T	A	4: 115,455,003	Y118N	probably damaging	Het
Dgki	A	T	6: 37,299,846		probably benign	Het
Disp2	A	G	2: 118,792,756	N1323S	probably damaging	Het
Dock1	T	A	7: 134,724,409	Y42*	probably null	Het
Eps8l1	C	A	7: 4,473,945	P471Q	probably damaging	Het
Fam20a	A	C	11: 109,721,687	L10R	unknown	Het
Fpr-rs4	T	A	17: 18,022,184	I151K	probably damaging	Het
Gga1	C	A	15: 78,885,309	P161T	probably damaging	Het
Gm8909	A	T	17: 36,165,858	H241Q	possibly damaging	Het
Gm9923	T	A	10: 72,309,476	Y52*	probably null	Het
Gucy2g	A	G	19: 55,206,256	F910L	probably damaging	Het
Helz	T	C	11: 107,649,145	V315A	probably damaging	Het
Hk2	T	C	6: 82,739,648	Y301C	probably damaging	Het
Htt	C	T	5: 34,852,765	P1521S	probably damaging	Het
Iah1	T	C	12: 21,316,433	M1T	probably null	Het
Ik	T	C	18: 36,752,414	S287P	probably damaging	Het
Itga1	T	A	13: 115,049,370	D32V	probably damaging	Het
Itpr2	A	G	6: 146,373,173	F837S	probably damaging	Het
Klk14	A	G	7: 43,691,968	I15V	probably benign	Het
Kng2	T	C	16: 22,987,641	I603V	possibly damaging	Het
Lama1	T	C	17: 67,773,778	I1267T	possibly damaging	Het
Lrp1b	A	C	2: 40,922,304	L2430V	probably benign	Het
Lrrn3	T	G	12: 41,454,244	K25Q	possibly damaging	Het
Lta4h	T	A	10: 93,468,816	N233K	probably benign	Het
Mapk13	T	C	17: 28,770,049	I53T	probably damaging	Het
Mdn1	T	C	4: 32,666,430	F123L	probably damaging	Het
Mettl7b	G	T	10: 128,960,702	C79*	probably null	Het
Myh4	G	C	11: 67,245,811	D472H	probably damaging	Het
Nipa2	A	T	7: 55,935,826	N121K	probably benign	Het
Nostrin	C	T	2: 69,183,924	T408M	probably benign	Het
Olfr347	A	G	2: 36,734,674	M118V	probably damaging	Het
Olfr725	T	C	14: 50,034,830	D191G	probably damaging	Het
Oosp2	C	T	19: 11,649,653	R102H	probably damaging	Het
Osgin2	T	A	4: 16,001,946	I202L	probably benign	Het
Pbld2	C	A	10: 63,057,697	R271S	probably damaging	Het
Pex6	C	T	17: 46,712,101	T201I	probably benign	Het
Pilra	T	C	5: 137,835,515	I96M	probably damaging	Het
Pllp	T	A	8: 94,677,278	D47V	possibly damaging	Het
Plxna2	A	G	1: 194,762,594	S765G	probably benign	Het
Prkca	A	T	11: 107,961,608	Y100N	probably damaging	Het
Prkg1	T	A	19: 31,664,179	K35*	probably null	Het
Psmc2	A	G	5: 21,803,265	D389G	possibly damaging	Het
Rnf213	A	G	11: 119,441,125	T2387A	probably damaging	Het
Ros1	T	C	10: 52,129,096	N914S	probably damaging	Het
Ruvbl1	C	A	6: 88,491,599	T367K	probably benign	Het
Scube2	C	T	7: 109,810,713	R525H	probably damaging	Het
Secisbp2l	T	C	2: 125,745,942	D751G	probably damaging	Het
Setd3	T	C	12: 108,108,690	D402G	probably benign	Het
Slc15a2	T	A	16: 36,757,849	K359N	probably damaging	Het
Slc25a21	A	G	12: 57,196,936	S2P	probably benign	Het
Slfn8	A	T	11: 83,017,506	H70Q	probably benign	Het
Spef2	T	C	15: 9,647,490	I944V	probably benign	Het
Spg11	A	G	2: 122,065,076	F1887S	probably damaging	Het
Sptbn4	T	C	7: 27,364,419	E879G	probably damaging	Het
Sptbn4	A	T	7: 27,366,735	D649E	possibly damaging	Het
Stx5a	C	A	19: 8,743,361	R121S	probably damaging	Het
Tbcd	T	C	11: 121,493,771	L26P	probably damaging	Het
Tecpr1	T	C	5: 144,207,437	D649G	probably benign	Het
Tfam	A	G	10: 71,237,847	S32P	probably benign	Het
Trmt44	C	T	5: 35,558,043	R642H	probably benign	Het
Trpm3	G	A	19: 22,987,781	A1547T	probably benign	Het
Ttll6	T	C	11: 96,153,177	V519A	probably benign	Het
Umodl1	T	C	17: 30,998,114	F1107L	probably benign	Het
Usp5	A	T	6: 124,817,956	V677E	probably damaging	Het
Utp20	A	T	10: 88,807,445	L605*	probably null	Het
Utrn	T	C	10: 12,745,240	D229G	probably damaging	Het
Uty	A	T	Y: 1,176,502	L178*	probably null	Het
Vmn2r88	A	T	14: 51,413,334	D168V	possibly damaging	Het
Vps13b	T	C	15: 35,646,178	V1476A	probably damaging	Het
Vps13b	C	T	15: 35,841,341	H2506Y	probably benign	Het
Vps13b	C	A	15: 35,879,821	T3014K	probably benign	Het
Vps37c	T	C	19: 10,712,768	V198A	probably benign	Het
Zfc3h1	T	C	10: 115,423,385	Y1621H	probably benign	Het
Zfp251	T	C	15: 76,854,407	D162G	possibly damaging	Het
Zfp292	T	C	4: 34,807,078	T1994A	probably benign	Het
Zfp791	A	G	8: 85,110,930	Y102H	probably benign	Het

Other mutations in Sec14l4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02581:Sec14l4	APN	11	4039941	missense	possibly damaging	0.49
R0308:Sec14l4	UTSW	11	4041726	splice site	probably benign
R0538:Sec14l4	UTSW	11	4040018	missense	probably benign
R2327:Sec14l4	UTSW	11	4040041	missense	probably benign	0.01
R2409:Sec14l4	UTSW	11	4040048	missense	probably benign	0.18
R2473:Sec14l4	UTSW	11	4043359	missense	probably benign	0.28
R4581:Sec14l4	UTSW	11	4043375	splice site	probably null
R5530:Sec14l4	UTSW	11	4046342	makesense	probably null
R5977:Sec14l4	UTSW	11	4040055	missense	possibly damaging	0.89
R6057:Sec14l4	UTSW	11	4035142	missense	possibly damaging	0.95
R7664:Sec14l4	UTSW	11	4044178	nonsense	probably null
R8465:Sec14l4	UTSW	11	4043948	missense	probably damaging	1.00
R9228:Sec14l4	UTSW	11	4039977	missense	probably damaging	1.00
R9753:Sec14l4	UTSW	11	4039982	missense	probably benign	0.13
X0026:Sec14l4	UTSW	11	4040100	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TATGTGCCAGAACCAAGGG -3'
(R):5'- TTCAGAAGAGTCAGCGCTGTG -3'

Sequencing Primer
(F):5'- GGCCACACTGGATGAATTTC -3'
(R):5'- CGCTGTGCTTTTGAGAGAAGC -3'

Posted On

2015-10-21