Incidental Mutation 'R4684:Fam20a'
ID 353543
Institutional Source Beutler Lab
Gene Symbol Fam20a
Ensembl Gene ENSMUSG00000020614
Gene Name family with sequence similarity 20, member A
Synonyms
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4684 (G1)
Quality Score 135
Status Not validated
Chromosome 11
Chromosomal Location 109669749-109722279 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 109721687 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Arginine at position 10 (L10R)
Ref Sequence ENSEMBL: ENSMUSP00000116687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020938] [ENSMUST00000155559]
AlphaFold Q8CID3
Predicted Effect unknown
Transcript: ENSMUST00000020938
AA Change: L10R
SMART Domains Protein: ENSMUSP00000020938
Gene: ENSMUSG00000020614
AA Change: L10R

DomainStartEndE-ValueType
transmembrane domain 9 28 N/A INTRINSIC
low complexity region 50 61 N/A INTRINSIC
Pfam:Fam20C 306 522 8.9e-101 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000155559
AA Change: L10R
SMART Domains Protein: ENSMUSP00000116687
Gene: ENSMUSG00000020614
AA Change: L10R

DomainStartEndE-ValueType
transmembrane domain 9 28 N/A INTRINSIC
low complexity region 50 61 N/A INTRINSIC
Pfam:DUF1193 305 525 3.2e-103 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype Strain: 5432376
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a protein that is likely secreted and may function in hematopoiesis. A mutation at this locus has been associated with amelogenesis imperfecta and gingival hyperplasia syndrome. Alternatively spliced transcript variants have been identified. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal ameloblast morphology, disrupted dental enamel formation in both incisor and molar teeth, abnormal kidney morphology, disseminated calcifications of muscular arteries, and intrapulmonary calcifications. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310039H08Rik T C 17: 46,772,946 (GRCm38) V45A probably benign Het
4921509C19Rik A G 2: 151,471,871 (GRCm38) I629T unknown Het
4933402N03Rik T C 7: 131,138,684 (GRCm38) R268G probably damaging Het
Abca13 A T 11: 9,434,193 (GRCm38) R3882* probably null Het
Adamts3 T G 5: 89,703,007 (GRCm38) T558P probably damaging Het
Ano2 A G 6: 125,790,341 (GRCm38) N214S probably benign Het
Arhgef4 A T 1: 34,811,785 (GRCm38) probably null Het
Boc C T 16: 44,500,380 (GRCm38) A306T probably benign Het
Capn10 T C 1: 92,943,781 (GRCm38) F367S probably damaging Het
Ccdc6 T C 10: 70,189,256 (GRCm38) probably benign Het
Cobll1 G T 2: 65,099,028 (GRCm38) S688R possibly damaging Het
Cpxm2 G T 7: 132,049,038 (GRCm38) P631Q possibly damaging Het
Cyp2c68 A G 19: 39,699,335 (GRCm38) V406A possibly damaging Het
Cyp4a30b T A 4: 115,455,003 (GRCm38) Y118N probably damaging Het
Dgki A T 6: 37,299,846 (GRCm38) probably benign Het
Disp2 A G 2: 118,792,756 (GRCm38) N1323S probably damaging Het
Dock1 T A 7: 134,724,409 (GRCm38) Y42* probably null Het
Eps8l1 C A 7: 4,473,945 (GRCm38) P471Q probably damaging Het
Fpr-rs4 T A 17: 18,022,184 (GRCm38) I151K probably damaging Het
Gga1 C A 15: 78,885,309 (GRCm38) P161T probably damaging Het
Gm8909 A T 17: 36,165,858 (GRCm38) H241Q possibly damaging Het
Gm9923 T A 10: 72,309,476 (GRCm38) Y52* probably null Het
Gucy2g A G 19: 55,206,256 (GRCm38) F910L probably damaging Het
Helz T C 11: 107,649,145 (GRCm38) V315A probably damaging Het
Hk2 T C 6: 82,739,648 (GRCm38) Y301C probably damaging Het
Htt C T 5: 34,852,765 (GRCm38) P1521S probably damaging Het
Iah1 T C 12: 21,316,433 (GRCm38) M1T probably null Het
Ik T C 18: 36,752,414 (GRCm38) S287P probably damaging Het
Itga1 T A 13: 115,049,370 (GRCm38) D32V probably damaging Het
Itpr2 A G 6: 146,373,173 (GRCm38) F837S probably damaging Het
Klk14 A G 7: 43,691,968 (GRCm38) I15V probably benign Het
Kng2 T C 16: 22,987,641 (GRCm38) I603V possibly damaging Het
Lama1 T C 17: 67,773,778 (GRCm38) I1267T possibly damaging Het
Lrp1b A C 2: 40,922,304 (GRCm38) L2430V probably benign Het
Lrrn3 T G 12: 41,454,244 (GRCm38) K25Q possibly damaging Het
Lta4h T A 10: 93,468,816 (GRCm38) N233K probably benign Het
Mapk13 T C 17: 28,770,049 (GRCm38) I53T probably damaging Het
Mdn1 T C 4: 32,666,430 (GRCm38) F123L probably damaging Het
Myh4 G C 11: 67,245,811 (GRCm38) D472H probably damaging Het
Nipa2 A T 7: 55,935,826 (GRCm38) N121K probably benign Het
Nostrin C T 2: 69,183,924 (GRCm38) T408M probably benign Het
Oosp2 C T 19: 11,649,653 (GRCm38) R102H probably damaging Het
Or1j18 A G 2: 36,734,674 (GRCm38) M118V probably damaging Het
Or4k15b T C 14: 50,034,830 (GRCm38) D191G probably damaging Het
Osgin2 T A 4: 16,001,946 (GRCm38) I202L probably benign Het
Pbld2 C A 10: 63,057,697 (GRCm38) R271S probably damaging Het
Pex6 C T 17: 46,712,101 (GRCm38) T201I probably benign Het
Pilra T C 5: 137,835,515 (GRCm38) I96M probably damaging Het
Pllp T A 8: 94,677,278 (GRCm38) D47V possibly damaging Het
Plxna2 A G 1: 194,762,594 (GRCm38) S765G probably benign Het
Prkca A T 11: 107,961,608 (GRCm38) Y100N probably damaging Het
Prkg1 T A 19: 31,664,179 (GRCm38) K35* probably null Het
Psmc2 A G 5: 21,803,265 (GRCm38) D389G possibly damaging Het
Rnf213 A G 11: 119,441,125 (GRCm38) T2387A probably damaging Het
Ros1 T C 10: 52,129,096 (GRCm38) N914S probably damaging Het
Ruvbl1 C A 6: 88,491,599 (GRCm38) T367K probably benign Het
Scube2 C T 7: 109,810,713 (GRCm38) R525H probably damaging Het
Sec14l4 T C 11: 4,035,200 (GRCm38) probably null Het
Secisbp2l T C 2: 125,745,942 (GRCm38) D751G probably damaging Het
Setd3 T C 12: 108,108,690 (GRCm38) D402G probably benign Het
Slc15a2 T A 16: 36,757,849 (GRCm38) K359N probably damaging Het
Slc25a21 A G 12: 57,196,936 (GRCm38) S2P probably benign Het
Slfn8 A T 11: 83,017,506 (GRCm38) H70Q probably benign Het
Spef2 T C 15: 9,647,490 (GRCm38) I944V probably benign Het
Spg11 A G 2: 122,065,076 (GRCm38) F1887S probably damaging Het
Sptbn4 A T 7: 27,366,735 (GRCm38) D649E possibly damaging Het
Sptbn4 T C 7: 27,364,419 (GRCm38) E879G probably damaging Het
Stx5a C A 19: 8,743,361 (GRCm38) R121S probably damaging Het
Tbcd T C 11: 121,493,771 (GRCm38) L26P probably damaging Het
Tecpr1 T C 5: 144,207,437 (GRCm38) D649G probably benign Het
Tfam A G 10: 71,237,847 (GRCm38) S32P probably benign Het
Tmt1b G T 10: 128,960,702 (GRCm38) C79* probably null Het
Trmt44 C T 5: 35,558,043 (GRCm38) R642H probably benign Het
Trpm3 G A 19: 22,987,781 (GRCm38) A1547T probably benign Het
Ttll6 T C 11: 96,153,177 (GRCm38) V519A probably benign Het
Umodl1 T C 17: 30,998,114 (GRCm38) F1107L probably benign Het
Usp5 A T 6: 124,817,956 (GRCm38) V677E probably damaging Het
Utp20 A T 10: 88,807,445 (GRCm38) L605* probably null Het
Utrn T C 10: 12,745,240 (GRCm38) D229G probably damaging Het
Uty A T Y: 1,176,502 (GRCm38) L178* probably null Het
Vmn2r88 A T 14: 51,413,334 (GRCm38) D168V possibly damaging Het
Vps13b T C 15: 35,646,178 (GRCm38) V1476A probably damaging Het
Vps13b C T 15: 35,841,341 (GRCm38) H2506Y probably benign Het
Vps13b C A 15: 35,879,821 (GRCm38) T3014K probably benign Het
Vps37c T C 19: 10,712,768 (GRCm38) V198A probably benign Het
Zfc3h1 T C 10: 115,423,385 (GRCm38) Y1621H probably benign Het
Zfp251 T C 15: 76,854,407 (GRCm38) D162G possibly damaging Het
Zfp292 T C 4: 34,807,078 (GRCm38) T1994A probably benign Het
Zfp791 A G 8: 85,110,930 (GRCm38) Y102H probably benign Het
Other mutations in Fam20a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00827:Fam20a APN 11 109,677,762 (GRCm38) splice site probably benign
IGL01296:Fam20a APN 11 109,685,351 (GRCm38) missense possibly damaging 0.93
IGL01319:Fam20a APN 11 109,678,458 (GRCm38) splice site probably benign
IGL01322:Fam20a APN 11 109,682,912 (GRCm38) missense probably damaging 1.00
IGL02086:Fam20a APN 11 109,673,413 (GRCm38) missense probably benign 0.00
IGL02563:Fam20a APN 11 109,677,794 (GRCm38) missense possibly damaging 0.53
IGL02883:Fam20a APN 11 109,675,127 (GRCm38) missense probably damaging 0.99
IGL02893:Fam20a APN 11 109,721,588 (GRCm38) missense probably benign 0.00
Infamy UTSW 11 109,673,342 (GRCm38) missense possibly damaging 0.87
snide UTSW 11 109,721,375 (GRCm38) missense possibly damaging 0.92
ungainly UTSW 11 109,682,870 (GRCm38) nonsense probably null
P0026:Fam20a UTSW 11 109,675,841 (GRCm38) critical splice donor site probably null
R0726:Fam20a UTSW 11 109,677,194 (GRCm38) missense probably damaging 1.00
R1317:Fam20a UTSW 11 109,677,838 (GRCm38) missense probably damaging 0.99
R1462:Fam20a UTSW 11 109,677,317 (GRCm38) missense probably damaging 1.00
R1462:Fam20a UTSW 11 109,677,317 (GRCm38) missense probably damaging 1.00
R1751:Fam20a UTSW 11 109,677,838 (GRCm38) missense probably damaging 0.99
R1761:Fam20a UTSW 11 109,677,838 (GRCm38) missense probably damaging 0.99
R1889:Fam20a UTSW 11 109,673,554 (GRCm38) missense probably benign 0.30
R1895:Fam20a UTSW 11 109,673,554 (GRCm38) missense probably benign 0.30
R1971:Fam20a UTSW 11 109,685,411 (GRCm38) missense probably damaging 1.00
R2192:Fam20a UTSW 11 109,674,623 (GRCm38) missense probably benign 0.13
R3745:Fam20a UTSW 11 109,677,790 (GRCm38) missense probably benign 0.17
R4835:Fam20a UTSW 11 109,673,563 (GRCm38) missense probably benign 0.40
R5045:Fam20a UTSW 11 109,677,885 (GRCm38) missense probably benign 0.38
R5161:Fam20a UTSW 11 109,673,370 (GRCm38) missense probably benign 0.00
R5715:Fam20a UTSW 11 109,678,431 (GRCm38) missense probably damaging 1.00
R5817:Fam20a UTSW 11 109,673,418 (GRCm38) missense possibly damaging 0.81
R5960:Fam20a UTSW 11 109,675,969 (GRCm38) intron probably benign
R6162:Fam20a UTSW 11 109,682,870 (GRCm38) nonsense probably null
R6312:Fam20a UTSW 11 109,674,630 (GRCm38) missense probably damaging 1.00
R7231:Fam20a UTSW 11 109,721,375 (GRCm38) missense possibly damaging 0.92
R7311:Fam20a UTSW 11 109,674,628 (GRCm38) nonsense probably null
R7366:Fam20a UTSW 11 109,673,342 (GRCm38) missense possibly damaging 0.87
R8013:Fam20a UTSW 11 109,685,506 (GRCm38) missense possibly damaging 0.92
R8014:Fam20a UTSW 11 109,685,506 (GRCm38) missense possibly damaging 0.92
R9086:Fam20a UTSW 11 109,675,928 (GRCm38) nonsense probably null
R9751:Fam20a UTSW 11 109,675,166 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAAAAGTTGTGCGAGGC -3'
(R):5'- CTCTACTGGGCAAGAAAAGACG -3'

Sequencing Primer
(F):5'- AAAAGTTGTGCGAGGCTGTGC -3'
(R):5'- ACGCTGTCAACACTGTGAG -3'
Posted On 2015-10-21