Mutagenetix > Incidental Mutation

Incidental Mutation 'R4684:Rnf213'

353544

Institutional Source

Beutler Lab

Gene Symbol

Rnf213

Ensembl Gene

ENSMUSG00000070327

Gene Name

ring finger protein 213

Synonyms

D11Ertd759e

Accession Numbers

Genbank: XM_001477846.2; Ensembl: ENSMUST00000131035, ENSMUST00000082107, ENSMUST00000093902, ENSMUST00000169768, ENSMUST00000172235

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4684 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

119393100-119487418 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 119441125 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 2387 (T2387A)

Ref Sequence

ENSEMBL: ENSMUSP00000115063 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093902] [ENSMUST00000131035]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000093902
AA Change: T2388A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000091429
Gene: ENSMUSG00000070327
AA Change: T2388A

Domain	Start	End	E-Value	Type
low complexity region	130	146	N/A	INTRINSIC
low complexity region	265	279	N/A	INTRINSIC
low complexity region	319	335	N/A	INTRINSIC
low complexity region	676	688	N/A	INTRINSIC
low complexity region	1114	1128	N/A	INTRINSIC
low complexity region	1546	1558	N/A	INTRINSIC
AAA	2373	2515	2.82e-2	SMART
AAA	2722	2890	3.63e-1	SMART
low complexity region	3449	3459	N/A	INTRINSIC
RING	3947	3985	8.69e-5	SMART
Blast:PP2Ac	4544	4722	3e-66	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000131035
AA Change: T2387A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000115063
Gene: ENSMUSG00000070327
AA Change: T2387A

Domain	Start	End	E-Value	Type
low complexity region	130	146	N/A	INTRINSIC
low complexity region	265	279	N/A	INTRINSIC
low complexity region	319	335	N/A	INTRINSIC
low complexity region	676	688	N/A	INTRINSIC
low complexity region	1113	1127	N/A	INTRINSIC
low complexity region	1545	1557	N/A	INTRINSIC
AAA	2372	2514	2.82e-2	SMART
AAA	2721	2889	3.63e-1	SMART
low complexity region	3448	3458	N/A	INTRINSIC
RING	3946	3984	8.69e-5	SMART
Blast:PP2Ac	4542	4720	3e-66	BLAST

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a C3HC4-type RING finger domain, which is a specialized type of Zn-finger that binds two atoms of zinc and is thought to be involved in mediating protein-protein interactions. The protein also contains an AAA domain, which is associated with ATPase activity. This gene is a susceptibility gene for Moyamoya disease, a vascular disorder of intracranial arteries. This gene is also a translocation partner in anaplastic large cell lymphoma and inflammatory myofibroblastic tumor cases, where a t(2;17)(p23;q25) translocation has been identified with the anaplastic lymphoma kinase (ALK) gene on chromosome 2, and a t(8;17)(q24;q25) translocation has been identified with the MYC gene on chromosome 8. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight and circulating glucose level but normal glucose tolerance, insulin sensitivity, insulin plasma levels and leptin plasma levels. [provided by MGI curators]

Allele List at MGI

All alleles(13) : Targeted, other(2) Gene trapped(11)

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310039H08Rik	T	C	17: 46,772,946	V45A	probably benign	Het
4921509C19Rik	A	G	2: 151,471,871	I629T	unknown	Het
4933402N03Rik	T	C	7: 131,138,684	R268G	probably damaging	Het
Abca13	A	T	11: 9,434,193	R3882*	probably null	Het
Adamts3	T	G	5: 89,703,007	T558P	probably damaging	Het
Ano2	A	G	6: 125,790,341	N214S	probably benign	Het
Arhgef4	A	T	1: 34,811,785		probably null	Het
Boc	C	T	16: 44,500,380	A306T	probably benign	Het
Capn10	T	C	1: 92,943,781	F367S	probably damaging	Het
Ccdc6	T	C	10: 70,189,256		probably benign	Het
Cobll1	G	T	2: 65,099,028	S688R	possibly damaging	Het
Cpxm2	G	T	7: 132,049,038	P631Q	possibly damaging	Het
Cyp2c68	A	G	19: 39,699,335	V406A	possibly damaging	Het
Cyp4a30b	T	A	4: 115,455,003	Y118N	probably damaging	Het
Dgki	A	T	6: 37,299,846		probably benign	Het
Disp2	A	G	2: 118,792,756	N1323S	probably damaging	Het
Dock1	T	A	7: 134,724,409	Y42*	probably null	Het
Eps8l1	C	A	7: 4,473,945	P471Q	probably damaging	Het
Fam20a	A	C	11: 109,721,687	L10R	unknown	Het
Fpr-rs4	T	A	17: 18,022,184	I151K	probably damaging	Het
Gga1	C	A	15: 78,885,309	P161T	probably damaging	Het
Gm8909	A	T	17: 36,165,858	H241Q	possibly damaging	Het
Gm9923	T	A	10: 72,309,476	Y52*	probably null	Het
Gucy2g	A	G	19: 55,206,256	F910L	probably damaging	Het
Helz	T	C	11: 107,649,145	V315A	probably damaging	Het
Hk2	T	C	6: 82,739,648	Y301C	probably damaging	Het
Htt	C	T	5: 34,852,765	P1521S	probably damaging	Het
Iah1	T	C	12: 21,316,433	M1T	probably null	Het
Ik	T	C	18: 36,752,414	S287P	probably damaging	Het
Itga1	T	A	13: 115,049,370	D32V	probably damaging	Het
Itpr2	A	G	6: 146,373,173	F837S	probably damaging	Het
Klk14	A	G	7: 43,691,968	I15V	probably benign	Het
Kng2	T	C	16: 22,987,641	I603V	possibly damaging	Het
Lama1	T	C	17: 67,773,778	I1267T	possibly damaging	Het
Lrp1b	A	C	2: 40,922,304	L2430V	probably benign	Het
Lrrn3	T	G	12: 41,454,244	K25Q	possibly damaging	Het
Lta4h	T	A	10: 93,468,816	N233K	probably benign	Het
Mapk13	T	C	17: 28,770,049	I53T	probably damaging	Het
Mdn1	T	C	4: 32,666,430	F123L	probably damaging	Het
Mettl7b	G	T	10: 128,960,702	C79*	probably null	Het
Myh4	G	C	11: 67,245,811	D472H	probably damaging	Het
Nipa2	A	T	7: 55,935,826	N121K	probably benign	Het
Nostrin	C	T	2: 69,183,924	T408M	probably benign	Het
Olfr347	A	G	2: 36,734,674	M118V	probably damaging	Het
Olfr725	T	C	14: 50,034,830	D191G	probably damaging	Het
Oosp2	C	T	19: 11,649,653	R102H	probably damaging	Het
Osgin2	T	A	4: 16,001,946	I202L	probably benign	Het
Pbld2	C	A	10: 63,057,697	R271S	probably damaging	Het
Pex6	C	T	17: 46,712,101	T201I	probably benign	Het
Pilra	T	C	5: 137,835,515	I96M	probably damaging	Het
Pllp	T	A	8: 94,677,278	D47V	possibly damaging	Het
Plxna2	A	G	1: 194,762,594	S765G	probably benign	Het
Prkca	A	T	11: 107,961,608	Y100N	probably damaging	Het
Prkg1	T	A	19: 31,664,179	K35*	probably null	Het
Psmc2	A	G	5: 21,803,265	D389G	possibly damaging	Het
Ros1	T	C	10: 52,129,096	N914S	probably damaging	Het
Ruvbl1	C	A	6: 88,491,599	T367K	probably benign	Het
Scube2	C	T	7: 109,810,713	R525H	probably damaging	Het
Sec14l4	T	C	11: 4,035,200		probably null	Het
Secisbp2l	T	C	2: 125,745,942	D751G	probably damaging	Het
Setd3	T	C	12: 108,108,690	D402G	probably benign	Het
Slc15a2	T	A	16: 36,757,849	K359N	probably damaging	Het
Slc25a21	A	G	12: 57,196,936	S2P	probably benign	Het
Slfn8	A	T	11: 83,017,506	H70Q	probably benign	Het
Spef2	T	C	15: 9,647,490	I944V	probably benign	Het
Spg11	A	G	2: 122,065,076	F1887S	probably damaging	Het
Sptbn4	T	C	7: 27,364,419	E879G	probably damaging	Het
Sptbn4	A	T	7: 27,366,735	D649E	possibly damaging	Het
Stx5a	C	A	19: 8,743,361	R121S	probably damaging	Het
Tbcd	T	C	11: 121,493,771	L26P	probably damaging	Het
Tecpr1	T	C	5: 144,207,437	D649G	probably benign	Het
Tfam	A	G	10: 71,237,847	S32P	probably benign	Het
Trmt44	C	T	5: 35,558,043	R642H	probably benign	Het
Trpm3	G	A	19: 22,987,781	A1547T	probably benign	Het
Ttll6	T	C	11: 96,153,177	V519A	probably benign	Het
Umodl1	T	C	17: 30,998,114	F1107L	probably benign	Het
Usp5	A	T	6: 124,817,956	V677E	probably damaging	Het
Utp20	A	T	10: 88,807,445	L605*	probably null	Het
Utrn	T	C	10: 12,745,240	D229G	probably damaging	Het
Uty	A	T	Y: 1,176,502	L178*	probably null	Het
Vmn2r88	A	T	14: 51,413,334	D168V	possibly damaging	Het
Vps13b	T	C	15: 35,646,178	V1476A	probably damaging	Het
Vps13b	C	T	15: 35,841,341	H2506Y	probably benign	Het
Vps13b	C	A	15: 35,879,821	T3014K	probably benign	Het
Vps37c	T	C	19: 10,712,768	V198A	probably benign	Het
Zfc3h1	T	C	10: 115,423,385	Y1621H	probably benign	Het
Zfp251	T	C	15: 76,854,407	D162G	possibly damaging	Het
Zfp292	T	C	4: 34,807,078	T1994A	probably benign	Het
Zfp791	A	G	8: 85,110,930	Y102H	probably benign	Het

Other mutations in Rnf213

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Rnf213	APN	11	119449343	missense	probably benign	0.00
IGL00961:Rnf213	APN	11	119440843	missense	possibly damaging	0.55
IGL01324:Rnf213	APN	11	119447237	missense	probably damaging	1.00
IGL01351:Rnf213	APN	11	119483118	missense	probably benign	0.25
IGL01403:Rnf213	APN	11	119443300	missense	probably damaging	1.00
IGL01704:Rnf213	APN	11	119449876	critical splice donor site	probably null
IGL01765:Rnf213	APN	11	119436352	missense	probably benign	0.00
IGL01803:Rnf213	APN	11	119441307	missense	probably damaging	1.00
IGL01804:Rnf213	APN	11	119442266	missense	probably damaging	1.00
IGL01900:Rnf213	APN	11	119443015	missense	probably benign	0.05
IGL01944:Rnf213	APN	11	119416457	missense	probably benign	0.01
IGL01982:Rnf213	APN	11	119443268	missense	probably damaging	1.00
IGL02008:Rnf213	APN	11	119418309	splice site	probably benign
IGL02084:Rnf213	APN	11	119445673	missense	probably benign	0.04
IGL02253:Rnf213	APN	11	119440650	missense	probably benign	0.03
IGL02254:Rnf213	APN	11	119480907	missense	possibly damaging	0.89
IGL02296:Rnf213	APN	11	119463336	missense	probably benign	0.01
IGL02531:Rnf213	APN	11	119436802	missense	probably benign
IGL02588:Rnf213	APN	11	119416536	missense	probably benign	0.30
IGL02615:Rnf213	APN	11	119440789	missense	probably damaging	0.96
IGL02805:Rnf213	APN	11	119435066	missense	probably damaging	0.99
IGL02887:Rnf213	APN	11	119427510	missense	probably damaging	1.00
IGL03001:Rnf213	APN	11	119479941	missense	probably damaging	1.00
IGL03035:Rnf213	APN	11	119445626	splice site	probably benign
IGL03057:Rnf213	APN	11	119441087	missense	probably damaging	1.00
IGL03148:Rnf213	APN	11	119465007	missense	probably damaging	1.00
IGL03308:Rnf213	APN	11	119474172	missense	probably benign	0.03
IGL03339:Rnf213	APN	11	119443004	missense	probably damaging	1.00
IGL03369:Rnf213	APN	11	119421468	missense	probably benign	0.34
attrition	UTSW	11	119430321	missense	possibly damaging	0.77
defame	UTSW	11	119430281	nonsense	probably null
Derogate	UTSW	11	119470210	missense	probably damaging	1.00
dinky	UTSW	11	119416458	missense	probably damaging	0.99
G1funyon_rnf213_024	UTSW	11	119434742	missense
Impugn	UTSW	11	119436823	nonsense	probably null
R4332_Rnf213_642	UTSW	11	119436676	missense	probably damaging	1.00
B6584:Rnf213	UTSW	11	119426069	missense	probably damaging	0.97
G1Funyon:Rnf213	UTSW	11	119434742	missense
PIT4585001:Rnf213	UTSW	11	119458392	missense
R0008:Rnf213	UTSW	11	119465052	missense	possibly damaging	0.82
R0015:Rnf213	UTSW	11	119441606	missense	possibly damaging	0.95
R0041:Rnf213	UTSW	11	119402575	missense	probably benign	0.41
R0114:Rnf213	UTSW	11	119414587	missense	probably damaging	1.00
R0131:Rnf213	UTSW	11	119430361	missense	probably benign	0.10
R0131:Rnf213	UTSW	11	119430361	missense	probably benign	0.10
R0132:Rnf213	UTSW	11	119430361	missense	probably benign	0.10
R0138:Rnf213	UTSW	11	119416496	missense	probably benign	0.05
R0144:Rnf213	UTSW	11	119479600	nonsense	probably null
R0184:Rnf213	UTSW	11	119414521	missense	probably damaging	0.99
R0321:Rnf213	UTSW	11	119438105	nonsense	probably null
R0365:Rnf213	UTSW	11	119426111	missense	possibly damaging	0.74
R0415:Rnf213	UTSW	11	119414469	missense	probably damaging	1.00
R0421:Rnf213	UTSW	11	119447257	missense	probably damaging	1.00
R0494:Rnf213	UTSW	11	119426012	missense	possibly damaging	0.65
R0494:Rnf213	UTSW	11	119443120	missense	probably damaging	1.00
R0549:Rnf213	UTSW	11	119465082	missense	probably damaging	1.00
R0577:Rnf213	UTSW	11	119443280	missense	probably damaging	1.00
R0605:Rnf213	UTSW	11	119431717	missense	probably benign	0.03
R0638:Rnf213	UTSW	11	119470210	missense	probably damaging	1.00
R0675:Rnf213	UTSW	11	119441834	missense	probably benign	0.28
R0715:Rnf213	UTSW	11	119441150	missense	probably damaging	0.97
R0732:Rnf213	UTSW	11	119441068	missense	probably damaging	0.99
R0748:Rnf213	UTSW	11	119473480	missense	probably damaging	1.00
R0765:Rnf213	UTSW	11	119423095	critical splice donor site	probably null
R0890:Rnf213	UTSW	11	119430486	missense	possibly damaging	0.94
R0927:Rnf213	UTSW	11	119414570	missense	probably benign	0.00
R0940:Rnf213	UTSW	11	119416563	missense	probably benign	0.10
R0959:Rnf213	UTSW	11	119452581	missense	probably damaging	0.99
R1077:Rnf213	UTSW	11	119485998	splice site	probably benign
R1104:Rnf213	UTSW	11	119477229	missense	probably benign	0.29
R1141:Rnf213	UTSW	11	119435983	missense	probably benign	0.02
R1219:Rnf213	UTSW	11	119436177	missense	probably damaging	1.00
R1435:Rnf213	UTSW	11	119436005	missense	probably damaging	1.00
R1444:Rnf213	UTSW	11	119442400	missense	probably damaging	1.00
R1474:Rnf213	UTSW	11	119437750	missense	probably damaging	1.00
R1488:Rnf213	UTSW	11	119480889	missense	probably benign	0.05
R1523:Rnf213	UTSW	11	119441888	missense	probably damaging	1.00
R1548:Rnf213	UTSW	11	119442707	missense	probably damaging	1.00
R1554:Rnf213	UTSW	11	119441839	missense	probably benign	0.06
R1563:Rnf213	UTSW	11	119414526	missense	probably benign	0.13
R1572:Rnf213	UTSW	11	119436611	missense	probably damaging	1.00
R1585:Rnf213	UTSW	11	119463345	missense	probably damaging	1.00
R1635:Rnf213	UTSW	11	119442579	missense	probably damaging	0.97
R1663:Rnf213	UTSW	11	119437672	missense	probably benign	0.01
R1789:Rnf213	UTSW	11	119440221	missense	probably damaging	0.97
R1844:Rnf213	UTSW	11	119441183	missense	probably damaging	1.00
R1871:Rnf213	UTSW	11	119450129	missense	probably benign	0.08
R1893:Rnf213	UTSW	11	119416448	missense	probably damaging	1.00
R1937:Rnf213	UTSW	11	119431685	missense	probably damaging	1.00
R1967:Rnf213	UTSW	11	119480895	missense	probably damaging	1.00
R1987:Rnf213	UTSW	11	119441107	missense	probably damaging	1.00
R2000:Rnf213	UTSW	11	119436022	missense	probably damaging	1.00
R2020:Rnf213	UTSW	11	119461918	missense	probably damaging	0.99
R2100:Rnf213	UTSW	11	119467302	nonsense	probably null
R2109:Rnf213	UTSW	11	119442663	nonsense	probably null
R2115:Rnf213	UTSW	11	119428013	missense	probably benign	0.00
R2126:Rnf213	UTSW	11	119450201	missense	probably damaging	0.99
R2144:Rnf213	UTSW	11	119443690	missense	probably damaging	0.99
R2145:Rnf213	UTSW	11	119415193	missense	probably benign	0.03
R2168:Rnf213	UTSW	11	119415070	missense	probably damaging	0.97
R2189:Rnf213	UTSW	11	119430361	missense	probably benign	0.10
R2199:Rnf213	UTSW	11	119460009	missense	probably benign	0.01
R2220:Rnf213	UTSW	11	119436428	missense	possibly damaging	0.94
R2336:Rnf213	UTSW	11	119414604	missense	probably benign	0.02
R2400:Rnf213	UTSW	11	119443195	missense	probably damaging	1.00
R2679:Rnf213	UTSW	11	119459938	splice site	probably null
R2698:Rnf213	UTSW	11	119410144	missense	probably benign	0.26
R3151:Rnf213	UTSW	11	119468892	missense	probably benign	0.03
R3607:Rnf213	UTSW	11	119441976	nonsense	probably null
R3808:Rnf213	UTSW	11	119479558	missense	probably damaging	1.00
R3854:Rnf213	UTSW	11	119480939	splice site	probably benign
R3856:Rnf213	UTSW	11	119480939	splice site	probably benign
R3973:Rnf213	UTSW	11	119469053	missense
R4014:Rnf213	UTSW	11	119445729	nonsense	probably null
R4049:Rnf213	UTSW	11	119482448	missense	possibly damaging	0.67
R4130:Rnf213	UTSW	11	119483006	missense	probably damaging	1.00
R4153:Rnf213	UTSW	11	119409482	missense	probably benign	0.27
R4167:Rnf213	UTSW	11	119441243	missense	probably damaging	0.99
R4224:Rnf213	UTSW	11	119436823	nonsense	probably null
R4332:Rnf213	UTSW	11	119436676	missense	probably damaging	1.00
R4415:Rnf213	UTSW	11	119483964	missense	probably damaging	0.99
R4547:Rnf213	UTSW	11	119479670	critical splice donor site	probably null
R4609:Rnf213	UTSW	11	119437695	missense	possibly damaging	0.86
R4704:Rnf213	UTSW	11	119440349	missense	probably damaging	1.00
R4719:Rnf213	UTSW	11	119420067	missense	probably benign	0.38
R4751:Rnf213	UTSW	11	119445745	missense	probably benign	0.12
R4828:Rnf213	UTSW	11	119416629	missense	possibly damaging	0.61
R4837:Rnf213	UTSW	11	119442763	missense	probably benign	0.00
R4894:Rnf213	UTSW	11	119481240	missense	probably damaging	1.00
R4973:Rnf213	UTSW	11	119428157	missense	possibly damaging	0.84
R5026:Rnf213	UTSW	11	119436764	missense	probably damaging	1.00
R5034:Rnf213	UTSW	11	119410807	missense	probably damaging	0.99
R5284:Rnf213	UTSW	11	119458866	missense	possibly damaging	0.89
R5295:Rnf213	UTSW	11	119440816	missense	probably benign	0.00
R5406:Rnf213	UTSW	11	119440808	missense	probably damaging	1.00
R5441:Rnf213	UTSW	11	119409020	missense	probably damaging	0.99
R5449:Rnf213	UTSW	11	119415076	missense	probably benign	0.44
R5520:Rnf213	UTSW	11	119433499	missense	probably damaging	1.00
R5636:Rnf213	UTSW	11	119436629	missense	probably benign	0.04
R5636:Rnf213	UTSW	11	119436905	missense	probably damaging	1.00
R5669:Rnf213	UTSW	11	119458785	missense	possibly damaging	0.92
R5670:Rnf213	UTSW	11	119434686	critical splice acceptor site	probably null
R5697:Rnf213	UTSW	11	119483894	missense	possibly damaging	0.54
R5726:Rnf213	UTSW	11	119416458	missense	probably damaging	0.99
R5808:Rnf213	UTSW	11	119436295	missense	probably benign
R5861:Rnf213	UTSW	11	119473377	missense	probably damaging	1.00
R5903:Rnf213	UTSW	11	119421369	missense	probably damaging	0.98
R5949:Rnf213	UTSW	11	119443079	missense	probably damaging	1.00
R6022:Rnf213	UTSW	11	119486010	missense	probably benign	0.00
R6043:Rnf213	UTSW	11	119442101	missense	probably damaging	0.97
R6089:Rnf213	UTSW	11	119416559	missense	probably benign	0.14
R6123:Rnf213	UTSW	11	119411513	missense	probably damaging	0.96
R6134:Rnf213	UTSW	11	119411470	missense	probably damaging	0.99
R6135:Rnf213	UTSW	11	119442028	missense	probably benign	0.02
R6146:Rnf213	UTSW	11	119435999	missense	probably benign	0.41
R6163:Rnf213	UTSW	11	119458428	missense	possibly damaging	0.86
R6272:Rnf213	UTSW	11	119414548	missense	probably damaging	1.00
R6333:Rnf213	UTSW	11	119463366	missense	probably damaging	1.00
R6370:Rnf213	UTSW	11	119477078	missense	probably damaging	0.99
R6456:Rnf213	UTSW	11	119459966	missense	probably benign	0.03
R6468:Rnf213	UTSW	11	119452687	missense	possibly damaging	0.94
R6579:Rnf213	UTSW	11	119436280	missense	probably damaging	0.96
R6648:Rnf213	UTSW	11	119479920	missense	possibly damaging	0.81
R6727:Rnf213	UTSW	11	119430321	missense	possibly damaging	0.77
R6739:Rnf213	UTSW	11	119442271	missense	probably damaging	1.00
R6768:Rnf213	UTSW	11	119442236	missense	probably damaging	0.99
R6817:Rnf213	UTSW	11	119462285	critical splice donor site	probably null
R6820:Rnf213	UTSW	11	119448838	missense	probably damaging	1.00
R6841:Rnf213	UTSW	11	119449866	missense	probably benign	0.26
R6934:Rnf213	UTSW	11	119420067	missense	probably benign	0.38
R7026:Rnf213	UTSW	11	119479655	missense	possibly damaging	0.58
R7094:Rnf213	UTSW	11	119437604	splice site	probably null
R7170:Rnf213	UTSW	11	119452575	missense
R7185:Rnf213	UTSW	11	119424198	missense
R7239:Rnf213	UTSW	11	119458788	missense
R7258:Rnf213	UTSW	11	119452575	missense
R7259:Rnf213	UTSW	11	119452575	missense
R7260:Rnf213	UTSW	11	119452575	missense
R7273:Rnf213	UTSW	11	119431756	splice site	probably null
R7282:Rnf213	UTSW	11	119437992	missense
R7311:Rnf213	UTSW	11	119416547	missense
R7352:Rnf213	UTSW	11	119443579	missense
R7369:Rnf213	UTSW	11	119430468	missense
R7410:Rnf213	UTSW	11	119435051	missense
R7448:Rnf213	UTSW	11	119481291	missense
R7561:Rnf213	UTSW	11	119441719	missense
R7573:Rnf213	UTSW	11	119458484	missense
R7615:Rnf213	UTSW	11	119467297	missense
R7680:Rnf213	UTSW	11	119479556	missense
R7739:Rnf213	UTSW	11	119410861	missense
R7789:Rnf213	UTSW	11	119470219	splice site	probably null
R7806:Rnf213	UTSW	11	119411545	missense
R8031:Rnf213	UTSW	11	119430281	nonsense	probably null
R8042:Rnf213	UTSW	11	119441654	missense
R8053:Rnf213	UTSW	11	119402647	missense
R8284:Rnf213	UTSW	11	119428083	missense
R8301:Rnf213	UTSW	11	119434742	missense
R8325:Rnf213	UTSW	11	119430445	missense
R8332:Rnf213	UTSW	11	119483698	missense
R8443:Rnf213	UTSW	11	119449323	missense
R8518:Rnf213	UTSW	11	119462217	missense
R8531:Rnf213	UTSW	11	119474205	missense	probably benign	0.02
R8670:Rnf213	UTSW	11	119458737	missense
R8675:Rnf213	UTSW	11	119456158	missense
R8690:Rnf213	UTSW	11	119418129	missense
R8690:Rnf213	UTSW	11	119441212	missense
R8714:Rnf213	UTSW	11	119468894	missense
R8802:Rnf213	UTSW	11	119462102	missense
R8861:Rnf213	UTSW	11	119442236	missense
R8886:Rnf213	UTSW	11	119473438	missense
R8893:Rnf213	UTSW	11	119443042	missense
R8937:Rnf213	UTSW	11	119430274	missense	possibly damaging	0.94
R8941:Rnf213	UTSW	11	119414424	missense	probably damaging	1.00
R8973:Rnf213	UTSW	11	119461930	missense
R8983:Rnf213	UTSW	11	119430349	missense
R9043:Rnf213	UTSW	11	119458913	missense
R9081:Rnf213	UTSW	11	119466236	missense
R9132:Rnf213	UTSW	11	119483916	missense
R9135:Rnf213	UTSW	11	119408747	missense
R9146:Rnf213	UTSW	11	119443673	missense
R9156:Rnf213	UTSW	11	119440748	missense
R9183:Rnf213	UTSW	11	119427622	missense
R9234:Rnf213	UTSW	11	119450117	missense
R9275:Rnf213	UTSW	11	119435942	missense
R9278:Rnf213	UTSW	11	119435942	missense
R9296:Rnf213	UTSW	11	119443795	splice site	probably benign
R9350:Rnf213	UTSW	11	119442149	missense
R9366:Rnf213	UTSW	11	119436231	missense
R9413:Rnf213	UTSW	11	119466233	missense
R9444:Rnf213	UTSW	11	119434797	missense
R9464:Rnf213	UTSW	11	119463580	missense
R9605:Rnf213	UTSW	11	119469053	missense
R9649:Rnf213	UTSW	11	119479631	missense
R9651:Rnf213	UTSW	11	119440412	missense
R9664:Rnf213	UTSW	11	119441968	missense
R9696:Rnf213	UTSW	11	119468980	missense
R9710:Rnf213	UTSW	11	119441005	missense
R9797:Rnf213	UTSW	11	119442539	missense
S24628:Rnf213	UTSW	11	119414469	missense	probably damaging	1.00
X0021:Rnf213	UTSW	11	119441824	missense	probably benign	0.14
X0062:Rnf213	UTSW	11	119473513	missense	probably benign	0.05
X0064:Rnf213	UTSW	11	119440463	missense	probably damaging	1.00
Z1088:Rnf213	UTSW	11	119477254	missense	possibly damaging	0.69
Z1176:Rnf213	UTSW	11	119441410	missense
Z1176:Rnf213	UTSW	11	119482998	missense

Predicted Primers

PCR Primer
(F):5'- AGTGCCCTTCAACATTGACTTTG -3'
(R):5'- TGTGTTGGCTTCATCAAAGAAC -3'

Sequencing Primer
(F):5'- TAACTTGCCCAGATATGAGAAGC -3'
(R):5'- TTGGCTTCATCAAAGAACAAGATGG -3'

Posted On

2015-10-21