Incidental Mutation 'R4684:Olfr725'
ID353551
Institutional Source Beutler Lab
Gene Symbol Olfr725
Ensembl Gene ENSMUSG00000068437
Gene Nameolfactory receptor 725
SynonymsMOR246-3, GA_x6K02T2PMLR-5725741-5724776, MOR246-7_p
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R4684 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location50034314-50040375 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50034830 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 191 (D191G)
Ref Sequence ENSEMBL: ENSMUSP00000145828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089844] [ENSMUST00000206920]
Predicted Effect probably damaging
Transcript: ENSMUST00000089844
AA Change: D191G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000087282
Gene: ENSMUSG00000068437
AA Change: D191G

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 4.7e-46 PFAM
Pfam:7TM_GPCR_Srsx 36 282 1.8e-7 PFAM
Pfam:7tm_1 41 287 5.8e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000206920
AA Change: D191G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310039H08Rik T C 17: 46,772,946 V45A probably benign Het
4921509C19Rik A G 2: 151,471,871 I629T unknown Het
4933402N03Rik T C 7: 131,138,684 R268G probably damaging Het
Abca13 A T 11: 9,434,193 R3882* probably null Het
Adamts3 T G 5: 89,703,007 T558P probably damaging Het
Ano2 A G 6: 125,790,341 N214S probably benign Het
Arhgef4 A T 1: 34,811,785 probably null Het
Boc C T 16: 44,500,380 A306T probably benign Het
Capn10 T C 1: 92,943,781 F367S probably damaging Het
Ccdc6 T C 10: 70,189,256 probably benign Het
Cobll1 G T 2: 65,099,028 S688R possibly damaging Het
Cpxm2 G T 7: 132,049,038 P631Q possibly damaging Het
Cyp2c68 A G 19: 39,699,335 V406A possibly damaging Het
Cyp4a30b T A 4: 115,455,003 Y118N probably damaging Het
Dgki A T 6: 37,299,846 probably benign Het
Disp2 A G 2: 118,792,756 N1323S probably damaging Het
Dock1 T A 7: 134,724,409 Y42* probably null Het
Eps8l1 C A 7: 4,473,945 P471Q probably damaging Het
Fam20a A C 11: 109,721,687 L10R unknown Het
Fpr-rs4 T A 17: 18,022,184 I151K probably damaging Het
Gga1 C A 15: 78,885,309 P161T probably damaging Het
Gm8909 A T 17: 36,165,858 H241Q possibly damaging Het
Gm9923 T A 10: 72,309,476 Y52* probably null Het
Gucy2g A G 19: 55,206,256 F910L probably damaging Het
Helz T C 11: 107,649,145 V315A probably damaging Het
Hk2 T C 6: 82,739,648 Y301C probably damaging Het
Htt C T 5: 34,852,765 P1521S probably damaging Het
Iah1 T C 12: 21,316,433 M1T probably null Het
Ik T C 18: 36,752,414 S287P probably damaging Het
Itga1 T A 13: 115,049,370 D32V probably damaging Het
Itpr2 A G 6: 146,373,173 F837S probably damaging Het
Klk14 A G 7: 43,691,968 I15V probably benign Het
Kng2 T C 16: 22,987,641 I603V possibly damaging Het
Lama1 T C 17: 67,773,778 I1267T possibly damaging Het
Lrp1b A C 2: 40,922,304 L2430V probably benign Het
Lrrn3 T G 12: 41,454,244 K25Q possibly damaging Het
Lta4h T A 10: 93,468,816 N233K probably benign Het
Mapk13 T C 17: 28,770,049 I53T probably damaging Het
Mdn1 T C 4: 32,666,430 F123L probably damaging Het
Mettl7b G T 10: 128,960,702 C79* probably null Het
Myh4 G C 11: 67,245,811 D472H probably damaging Het
Nipa2 A T 7: 55,935,826 N121K probably benign Het
Nostrin C T 2: 69,183,924 T408M probably benign Het
Olfr347 A G 2: 36,734,674 M118V probably damaging Het
Oosp2 C T 19: 11,649,653 R102H probably damaging Het
Osgin2 T A 4: 16,001,946 I202L probably benign Het
Pbld2 C A 10: 63,057,697 R271S probably damaging Het
Pex6 C T 17: 46,712,101 T201I probably benign Het
Pilra T C 5: 137,835,515 I96M probably damaging Het
Pllp T A 8: 94,677,278 D47V possibly damaging Het
Plxna2 A G 1: 194,762,594 S765G probably benign Het
Prkca A T 11: 107,961,608 Y100N probably damaging Het
Prkg1 T A 19: 31,664,179 K35* probably null Het
Psmc2 A G 5: 21,803,265 D389G possibly damaging Het
Rnf213 A G 11: 119,441,125 T2387A probably damaging Het
Ros1 T C 10: 52,129,096 N914S probably damaging Het
Ruvbl1 C A 6: 88,491,599 T367K probably benign Het
Scube2 C T 7: 109,810,713 R525H probably damaging Het
Sec14l4 T C 11: 4,035,200 probably null Het
Secisbp2l T C 2: 125,745,942 D751G probably damaging Het
Setd3 T C 12: 108,108,690 D402G probably benign Het
Slc15a2 T A 16: 36,757,849 K359N probably damaging Het
Slc25a21 A G 12: 57,196,936 S2P probably benign Het
Slfn8 A T 11: 83,017,506 H70Q probably benign Het
Spef2 T C 15: 9,647,490 I944V probably benign Het
Spg11 A G 2: 122,065,076 F1887S probably damaging Het
Sptbn4 T C 7: 27,364,419 E879G probably damaging Het
Sptbn4 A T 7: 27,366,735 D649E possibly damaging Het
Stx5a C A 19: 8,743,361 R121S probably damaging Het
Tbcd T C 11: 121,493,771 L26P probably damaging Het
Tecpr1 T C 5: 144,207,437 D649G probably benign Het
Tfam A G 10: 71,237,847 S32P probably benign Het
Trmt44 C T 5: 35,558,043 R642H probably benign Het
Trpm3 G A 19: 22,987,781 A1547T probably benign Het
Ttll6 T C 11: 96,153,177 V519A probably benign Het
Umodl1 T C 17: 30,998,114 F1107L probably benign Het
Usp5 A T 6: 124,817,956 V677E probably damaging Het
Utp20 A T 10: 88,807,445 L605* probably null Het
Utrn T C 10: 12,745,240 D229G probably damaging Het
Uty A T Y: 1,176,502 L178* probably null Het
Vmn2r88 A T 14: 51,413,334 D168V possibly damaging Het
Vps13b T C 15: 35,646,178 V1476A probably damaging Het
Vps13b C T 15: 35,841,341 H2506Y probably benign Het
Vps13b C A 15: 35,879,821 T3014K probably benign Het
Vps37c T C 19: 10,712,768 V198A probably benign Het
Zfc3h1 T C 10: 115,423,385 Y1621H probably benign Het
Zfp251 T C 15: 76,854,407 D162G possibly damaging Het
Zfp292 T C 4: 34,807,078 T1994A probably benign Het
Zfp791 A G 8: 85,110,930 Y102H probably benign Het
Other mutations in Olfr725
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01116:Olfr725 APN 14 50035050 missense probably benign 0.29
IGL01412:Olfr725 APN 14 50035313 missense probably benign
IGL03241:Olfr725 APN 14 50035068 missense possibly damaging 0.70
IGL03268:Olfr725 APN 14 50034567 missense probably damaging 0.98
IGL03348:Olfr725 APN 14 50034755 missense probably benign 0.00
R0358:Olfr725 UTSW 14 50035286 missense probably damaging 0.97
R0577:Olfr725 UTSW 14 50034792 missense probably damaging 1.00
R2094:Olfr725 UTSW 14 50034714 missense probably damaging 1.00
R2424:Olfr725 UTSW 14 50034824 missense probably damaging 1.00
R3421:Olfr725 UTSW 14 50034540 missense possibly damaging 0.66
R3422:Olfr725 UTSW 14 50034540 missense possibly damaging 0.66
R4436:Olfr725 UTSW 14 50034830 missense probably damaging 1.00
R4437:Olfr725 UTSW 14 50034830 missense probably damaging 1.00
R4438:Olfr725 UTSW 14 50034830 missense probably damaging 1.00
R4717:Olfr725 UTSW 14 50035364 missense probably damaging 0.98
R5253:Olfr725 UTSW 14 50035288 missense possibly damaging 0.91
R5254:Olfr725 UTSW 14 50034678 missense possibly damaging 0.60
R5641:Olfr725 UTSW 14 50035289 missense probably benign 0.04
R5881:Olfr725 UTSW 14 50034987 missense probably benign 0.00
R5906:Olfr725 UTSW 14 50034849 missense probably benign 0.05
R6511:Olfr725 UTSW 14 50034809 missense probably damaging 1.00
R7837:Olfr725 UTSW 14 50034576 missense probably damaging 1.00
R7920:Olfr725 UTSW 14 50034576 missense probably damaging 1.00
X0062:Olfr725 UTSW 14 50034860 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCAACTGAATAGCCATTAAAGGG -3'
(R):5'- GACAATCATGAGTCGCCGTG -3'

Sequencing Primer
(F):5'- CCATTAAAGGGCCATGCATAG -3'
(R):5'- AGTCGCCGTGTGTGTATCACTC -3'
Posted On2015-10-21