Incidental Mutation 'R4684:Pex6'
ID353566
Institutional Source Beutler Lab
Gene Symbol Pex6
Ensembl Gene ENSMUSG00000002763
Gene Nameperoxisomal biogenesis factor 6
SynonymsD130055I09Rik
Accession Numbers

Genbank: NM_145488; Ensembl: ENSMUSP00000002840

Is this an essential gene? Possibly essential (E-score: 0.692) question?
Stock #R4684 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location46711463-46725541 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 46712101 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 201 (T201I)
Ref Sequence ENSEMBL: ENSMUSP00000002840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002840]
Predicted Effect probably benign
Transcript: ENSMUST00000002840
AA Change: T201I

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000002840
Gene: ENSMUSG00000002763
AA Change: T201I

DomainStartEndE-ValueType
low complexity region 17 31 N/A INTRINSIC
low complexity region 72 86 N/A INTRINSIC
low complexity region 87 104 N/A INTRINSIC
low complexity region 112 128 N/A INTRINSIC
low complexity region 173 200 N/A INTRINSIC
AAA 463 598 6.1e-7 SMART
AAA 737 875 6e-24 SMART
Blast:AAA 928 973 1e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127897
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144964
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181301
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AAA (ATPases associated with diverse cellular activities) family of ATPases. This member is a predominantly cytoplasmic protein, which plays a direct role in peroxisomal protein import and is required for PTS1 (peroxisomal targeting signal 1, a C-terminal tripeptide of the sequence ser-lys-leu) receptor activity. Mutations in this gene cause peroxisome biogenesis disorders of complementation group 4 and complementation group 6. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310039H08Rik T C 17: 46,772,946 V45A probably benign Het
4921509C19Rik A G 2: 151,471,871 I629T unknown Het
4933402N03Rik T C 7: 131,138,684 R268G probably damaging Het
Abca13 A T 11: 9,434,193 R3882* probably null Het
Adamts3 T G 5: 89,703,007 T558P probably damaging Het
Ano2 A G 6: 125,790,341 N214S probably benign Het
Arhgef4 A T 1: 34,811,785 probably null Het
Boc C T 16: 44,500,380 A306T probably benign Het
Capn10 T C 1: 92,943,781 F367S probably damaging Het
Ccdc6 T C 10: 70,189,256 probably benign Het
Cobll1 G T 2: 65,099,028 S688R possibly damaging Het
Cpxm2 G T 7: 132,049,038 P631Q possibly damaging Het
Cyp2c68 A G 19: 39,699,335 V406A possibly damaging Het
Cyp4a30b T A 4: 115,455,003 Y118N probably damaging Het
Dgki A T 6: 37,299,846 probably benign Het
Disp2 A G 2: 118,792,756 N1323S probably damaging Het
Dock1 T A 7: 134,724,409 Y42* probably null Het
Eps8l1 C A 7: 4,473,945 P471Q probably damaging Het
Fam20a A C 11: 109,721,687 L10R unknown Het
Fpr-rs4 T A 17: 18,022,184 I151K probably damaging Het
Gga1 C A 15: 78,885,309 P161T probably damaging Het
Gm8909 A T 17: 36,165,858 H241Q possibly damaging Het
Gm9923 T A 10: 72,309,476 Y52* probably null Het
Gucy2g A G 19: 55,206,256 F910L probably damaging Het
Helz T C 11: 107,649,145 V315A probably damaging Het
Hk2 T C 6: 82,739,648 Y301C probably damaging Het
Htt C T 5: 34,852,765 P1521S probably damaging Het
Iah1 T C 12: 21,316,433 M1T probably null Het
Ik T C 18: 36,752,414 S287P probably damaging Het
Itga1 T A 13: 115,049,370 D32V probably damaging Het
Itpr2 A G 6: 146,373,173 F837S probably damaging Het
Klk14 A G 7: 43,691,968 I15V probably benign Het
Kng2 T C 16: 22,987,641 I603V possibly damaging Het
Lama1 T C 17: 67,773,778 I1267T possibly damaging Het
Lrp1b A C 2: 40,922,304 L2430V probably benign Het
Lrrn3 T G 12: 41,454,244 K25Q possibly damaging Het
Lta4h T A 10: 93,468,816 N233K probably benign Het
Mapk13 T C 17: 28,770,049 I53T probably damaging Het
Mdn1 T C 4: 32,666,430 F123L probably damaging Het
Mettl7b G T 10: 128,960,702 C79* probably null Het
Myh4 G C 11: 67,245,811 D472H probably damaging Het
Nipa2 A T 7: 55,935,826 N121K probably benign Het
Nostrin C T 2: 69,183,924 T408M probably benign Het
Olfr347 A G 2: 36,734,674 M118V probably damaging Het
Olfr725 T C 14: 50,034,830 D191G probably damaging Het
Oosp2 C T 19: 11,649,653 R102H probably damaging Het
Osgin2 T A 4: 16,001,946 I202L probably benign Het
Pbld2 C A 10: 63,057,697 R271S probably damaging Het
Pilra T C 5: 137,835,515 I96M probably damaging Het
Pllp T A 8: 94,677,278 D47V possibly damaging Het
Plxna2 A G 1: 194,762,594 S765G probably benign Het
Prkca A T 11: 107,961,608 Y100N probably damaging Het
Prkg1 T A 19: 31,664,179 K35* probably null Het
Psmc2 A G 5: 21,803,265 D389G possibly damaging Het
Rnf213 A G 11: 119,441,125 T2387A probably damaging Het
Ros1 T C 10: 52,129,096 N914S probably damaging Het
Ruvbl1 C A 6: 88,491,599 T367K probably benign Het
Scube2 C T 7: 109,810,713 R525H probably damaging Het
Sec14l4 T C 11: 4,035,200 probably null Het
Secisbp2l T C 2: 125,745,942 D751G probably damaging Het
Setd3 T C 12: 108,108,690 D402G probably benign Het
Slc15a2 T A 16: 36,757,849 K359N probably damaging Het
Slc25a21 A G 12: 57,196,936 S2P probably benign Het
Slfn8 A T 11: 83,017,506 H70Q probably benign Het
Spef2 T C 15: 9,647,490 I944V probably benign Het
Spg11 A G 2: 122,065,076 F1887S probably damaging Het
Sptbn4 T C 7: 27,364,419 E879G probably damaging Het
Sptbn4 A T 7: 27,366,735 D649E possibly damaging Het
Stx5a C A 19: 8,743,361 R121S probably damaging Het
Tbcd T C 11: 121,493,771 L26P probably damaging Het
Tecpr1 T C 5: 144,207,437 D649G probably benign Het
Tfam A G 10: 71,237,847 S32P probably benign Het
Trmt44 C T 5: 35,558,043 R642H probably benign Het
Trpm3 G A 19: 22,987,781 A1547T probably benign Het
Ttll6 T C 11: 96,153,177 V519A probably benign Het
Umodl1 T C 17: 30,998,114 F1107L probably benign Het
Usp5 A T 6: 124,817,956 V677E probably damaging Het
Utp20 A T 10: 88,807,445 L605* probably null Het
Utrn T C 10: 12,745,240 D229G probably damaging Het
Uty A T Y: 1,176,502 L178* probably null Het
Vmn2r88 A T 14: 51,413,334 D168V possibly damaging Het
Vps13b T C 15: 35,646,178 V1476A probably damaging Het
Vps13b C T 15: 35,841,341 H2506Y probably benign Het
Vps13b C A 15: 35,879,821 T3014K probably benign Het
Vps37c T C 19: 10,712,768 V198A probably benign Het
Zfc3h1 T C 10: 115,423,385 Y1621H probably benign Het
Zfp251 T C 15: 76,854,407 D162G possibly damaging Het
Zfp292 T C 4: 34,807,078 T1994A probably benign Het
Zfp791 A G 8: 85,110,930 Y102H probably benign Het
Other mutations in Pex6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01478:Pex6 APN 17 46725304 missense probably benign 0.00
IGL01601:Pex6 APN 17 46723724 missense probably damaging 1.00
IGL01710:Pex6 APN 17 46725326 unclassified probably benign
IGL02392:Pex6 APN 17 46723499 missense probably damaging 1.00
IGL02419:Pex6 APN 17 46724435 missense possibly damaging 0.69
G5030:Pex6 UTSW 17 46715456 intron probably benign
R0091:Pex6 UTSW 17 46711918 missense probably damaging 1.00
R0243:Pex6 UTSW 17 46723737 critical splice donor site probably null
R0732:Pex6 UTSW 17 46724700 missense probably damaging 1.00
R1529:Pex6 UTSW 17 46714064 missense probably benign 0.10
R1602:Pex6 UTSW 17 46712137 missense probably benign 0.09
R1638:Pex6 UTSW 17 46722632 missense probably benign
R1757:Pex6 UTSW 17 46723498 missense probably damaging 1.00
R3769:Pex6 UTSW 17 46724385 splice site probably null
R4731:Pex6 UTSW 17 46722288 missense probably benign 0.02
R4731:Pex6 UTSW 17 46724707 splice site probably null
R4732:Pex6 UTSW 17 46722288 missense probably benign 0.02
R4732:Pex6 UTSW 17 46724707 splice site probably null
R4733:Pex6 UTSW 17 46722288 missense probably benign 0.02
R4733:Pex6 UTSW 17 46724707 splice site probably null
R4915:Pex6 UTSW 17 46714056 missense probably damaging 0.96
R5996:Pex6 UTSW 17 46714458 splice site probably null
R6156:Pex6 UTSW 17 46720641 missense probably benign 0.02
R6227:Pex6 UTSW 17 46712108 missense probably benign 0.00
R7054:Pex6 UTSW 17 46720521 missense probably benign
R7635:Pex6 UTSW 17 46724017 missense probably damaging 1.00
R8034:Pex6 UTSW 17 46722399 missense possibly damaging 0.67
R8177:Pex6 UTSW 17 46714062 missense probably benign
R8330:Pex6 UTSW 17 46712134 missense possibly damaging 0.55
R8348:Pex6 UTSW 17 46723113 missense probably benign
R8695:Pex6 UTSW 17 46712049 missense probably damaging 0.97
Z1088:Pex6 UTSW 17 46712222 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- ATCGCGAGTGTTGGAGAC -3'
(R):5'- GTCACAGCCGAGATTAAAAGC -3'

Sequencing Primer
(F):5'- AGTGTTGGAGACGCGACC -3'
(R):5'- GGGCAGAAACACCAGTCCG -3'
Posted On2015-10-21