Incidental Mutation 'R4684:Lama1'
ID 353568
Institutional Source Beutler Lab
Gene Symbol Lama1
Ensembl Gene ENSMUSG00000032796
Gene Name laminin, alpha 1
Synonyms Lama
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4684 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 68004254-68129642 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 68080773 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 1267 (I1267T)
Ref Sequence ENSEMBL: ENSMUSP00000043957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035471]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000035471
AA Change: I1267T

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000043957
Gene: ENSMUSG00000032796
AA Change: I1267T

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
LamNT 23 275 1.2e-131 SMART
EGF_Lam 277 331 1e-5 SMART
EGF_Lam 334 401 6.6e-6 SMART
EGF_Lam 404 458 9.11e-9 SMART
EGF_Lam 461 507 8.12e-6 SMART
LamB 570 702 2.09e-57 SMART
EGF_like 715 746 3.36e0 SMART
EGF_Lam 749 795 7.01e-10 SMART
EGF_Lam 798 853 3.59e-7 SMART
EGF_Lam 856 906 1.53e-10 SMART
EGF_Lam 909 955 1.13e-13 SMART
EGF_Lam 958 1002 1.36e-7 SMART
EGF_Lam 1005 1048 7.29e-8 SMART
EGF_like 1034 1082 4.83e1 SMART
EGF_Lam 1051 1094 1.67e-7 SMART
EGF_Lam 1097 1154 1.32e-5 SMART
LamB 1220 1352 8.7e-46 SMART
Pfam:Laminin_EGF 1367 1397 1.7e-6 PFAM
EGF_Lam 1410 1456 7.12e-11 SMART
EGF_Lam 1459 1513 3.25e-5 SMART
EGF_like 1497 1547 6.41e1 SMART
EGF_Lam 1516 1560 1.71e-13 SMART
Pfam:Laminin_I 1574 1838 1.7e-91 PFAM
low complexity region 2012 2031 N/A INTRINSIC
low complexity region 2087 2098 N/A INTRINSIC
LamG 2145 2287 3.66e-30 SMART
LamG 2332 2473 5.98e-35 SMART
LamG 2513 2661 1.11e-29 SMART
low complexity region 2695 2708 N/A INTRINSIC
LamG 2743 2877 9.72e-35 SMART
LamG 2920 3056 4.63e-41 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the alpha 1 subunits of laminin. The laminins are a family of extracellular matrix glycoproteins that have a heterotrimeric structure consisting of an alpha, beta and gamma chain. These proteins make up a major component of the basement membrane and have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Mutations in this gene may be associated with Poretti-Boltshauser syndrome. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation with impaired formation of Reichert's membrane. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310039H08Rik T C 17: 47,083,872 (GRCm39) V45A probably benign Het
4921509C19Rik A G 2: 151,313,791 (GRCm39) I629T unknown Het
4933402N03Rik T C 7: 130,740,413 (GRCm39) R268G probably damaging Het
Abca13 A T 11: 9,384,193 (GRCm39) R3882* probably null Het
Adamts3 T G 5: 89,850,866 (GRCm39) T558P probably damaging Het
Ano2 A G 6: 125,767,304 (GRCm39) N214S probably benign Het
Arhgef4 A T 1: 34,850,866 (GRCm39) probably null Het
Boc C T 16: 44,320,743 (GRCm39) A306T probably benign Het
Capn10 T C 1: 92,871,503 (GRCm39) F367S probably damaging Het
Ccdc6 T C 10: 70,025,086 (GRCm39) probably benign Het
Cobll1 G T 2: 64,929,372 (GRCm39) S688R possibly damaging Het
Cpxm2 G T 7: 131,650,767 (GRCm39) P631Q possibly damaging Het
Cyp2c68 A G 19: 39,687,779 (GRCm39) V406A possibly damaging Het
Cyp4a30b T A 4: 115,312,200 (GRCm39) Y118N probably damaging Het
Dgki A T 6: 37,276,781 (GRCm39) probably benign Het
Disp2 A G 2: 118,623,237 (GRCm39) N1323S probably damaging Het
Dock1 T A 7: 134,326,138 (GRCm39) Y42* probably null Het
Eps8l1 C A 7: 4,476,944 (GRCm39) P471Q probably damaging Het
Fam20a A C 11: 109,612,513 (GRCm39) L10R unknown Het
Fpr-rs4 T A 17: 18,242,446 (GRCm39) I151K probably damaging Het
Gga1 C A 15: 78,769,509 (GRCm39) P161T probably damaging Het
Gm9923 T A 10: 72,145,306 (GRCm39) Y52* probably null Het
Gucy2g A G 19: 55,194,688 (GRCm39) F910L probably damaging Het
H2-T5 A T 17: 36,476,750 (GRCm39) H241Q possibly damaging Het
Helz T C 11: 107,539,971 (GRCm39) V315A probably damaging Het
Hk2 T C 6: 82,716,629 (GRCm39) Y301C probably damaging Het
Htt C T 5: 35,010,109 (GRCm39) P1521S probably damaging Het
Iah1 T C 12: 21,366,434 (GRCm39) M1T probably null Het
Ik T C 18: 36,885,467 (GRCm39) S287P probably damaging Het
Itga1 T A 13: 115,185,906 (GRCm39) D32V probably damaging Het
Itpr2 A G 6: 146,274,671 (GRCm39) F837S probably damaging Het
Klk14 A G 7: 43,341,392 (GRCm39) I15V probably benign Het
Kng2 T C 16: 22,806,391 (GRCm39) I603V possibly damaging Het
Lrp1b A C 2: 40,812,316 (GRCm39) L2430V probably benign Het
Lrrn3 T G 12: 41,504,243 (GRCm39) K25Q possibly damaging Het
Lta4h T A 10: 93,304,678 (GRCm39) N233K probably benign Het
Mapk13 T C 17: 28,989,023 (GRCm39) I53T probably damaging Het
Mdn1 T C 4: 32,666,430 (GRCm39) F123L probably damaging Het
Myh4 G C 11: 67,136,637 (GRCm39) D472H probably damaging Het
Nipa2 A T 7: 55,585,574 (GRCm39) N121K probably benign Het
Nostrin C T 2: 69,014,268 (GRCm39) T408M probably benign Het
Oosp2 C T 19: 11,627,017 (GRCm39) R102H probably damaging Het
Or1j18 A G 2: 36,624,686 (GRCm39) M118V probably damaging Het
Or4k15b T C 14: 50,272,287 (GRCm39) D191G probably damaging Het
Osgin2 T A 4: 16,001,946 (GRCm39) I202L probably benign Het
Pbld2 C A 10: 62,893,476 (GRCm39) R271S probably damaging Het
Pex6 C T 17: 47,023,027 (GRCm39) T201I probably benign Het
Pilra T C 5: 137,833,777 (GRCm39) I96M probably damaging Het
Pllp T A 8: 95,403,906 (GRCm39) D47V possibly damaging Het
Plxna2 A G 1: 194,444,902 (GRCm39) S765G probably benign Het
Prkca A T 11: 107,852,434 (GRCm39) Y100N probably damaging Het
Prkg1 T A 19: 31,641,579 (GRCm39) K35* probably null Het
Psmc2 A G 5: 22,008,263 (GRCm39) D389G possibly damaging Het
Rnf213 A G 11: 119,331,951 (GRCm39) T2387A probably damaging Het
Ros1 T C 10: 52,005,192 (GRCm39) N914S probably damaging Het
Ruvbl1 C A 6: 88,468,581 (GRCm39) T367K probably benign Het
Scube2 C T 7: 109,409,920 (GRCm39) R525H probably damaging Het
Sec14l4 T C 11: 3,985,200 (GRCm39) probably null Het
Secisbp2l T C 2: 125,587,862 (GRCm39) D751G probably damaging Het
Setd3 T C 12: 108,074,949 (GRCm39) D402G probably benign Het
Slc15a2 T A 16: 36,578,211 (GRCm39) K359N probably damaging Het
Slc25a21 A G 12: 57,243,721 (GRCm39) S2P probably benign Het
Slfn8 A T 11: 82,908,332 (GRCm39) H70Q probably benign Het
Spef2 T C 15: 9,647,576 (GRCm39) I944V probably benign Het
Spg11 A G 2: 121,895,557 (GRCm39) F1887S probably damaging Het
Sptbn4 A T 7: 27,066,160 (GRCm39) D649E possibly damaging Het
Sptbn4 T C 7: 27,063,844 (GRCm39) E879G probably damaging Het
Stx5a C A 19: 8,720,725 (GRCm39) R121S probably damaging Het
Tbcd T C 11: 121,384,597 (GRCm39) L26P probably damaging Het
Tecpr1 T C 5: 144,144,255 (GRCm39) D649G probably benign Het
Tfam A G 10: 71,073,677 (GRCm39) S32P probably benign Het
Tmt1b G T 10: 128,796,571 (GRCm39) C79* probably null Het
Trmt44 C T 5: 35,715,387 (GRCm39) R642H probably benign Het
Trpm3 G A 19: 22,965,145 (GRCm39) A1547T probably benign Het
Ttll6 T C 11: 96,044,003 (GRCm39) V519A probably benign Het
Umodl1 T C 17: 31,217,088 (GRCm39) F1107L probably benign Het
Usp5 A T 6: 124,794,919 (GRCm39) V677E probably damaging Het
Utp20 A T 10: 88,643,307 (GRCm39) L605* probably null Het
Utrn T C 10: 12,620,984 (GRCm39) D229G probably damaging Het
Uty A T Y: 1,176,502 (GRCm39) L178* probably null Het
Vmn2r88 A T 14: 51,650,791 (GRCm39) D168V possibly damaging Het
Vps13b T C 15: 35,646,324 (GRCm39) V1476A probably damaging Het
Vps13b C A 15: 35,879,967 (GRCm39) T3014K probably benign Het
Vps13b C T 15: 35,841,487 (GRCm39) H2506Y probably benign Het
Vps37c T C 19: 10,690,132 (GRCm39) V198A probably benign Het
Zfc3h1 T C 10: 115,259,290 (GRCm39) Y1621H probably benign Het
Zfp251 T C 15: 76,738,607 (GRCm39) D162G possibly damaging Het
Zfp292 T C 4: 34,807,078 (GRCm39) T1994A probably benign Het
Zfp791 A G 8: 85,837,559 (GRCm39) Y102H probably benign Het
Other mutations in Lama1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Lama1 APN 17 68,122,923 (GRCm39) missense probably benign
IGL00336:Lama1 APN 17 68,120,943 (GRCm39) missense probably benign 0.07
IGL01066:Lama1 APN 17 68,050,321 (GRCm39) missense probably damaging 1.00
IGL01140:Lama1 APN 17 68,109,928 (GRCm39) missense probably benign 0.14
IGL01291:Lama1 APN 17 68,045,865 (GRCm39) missense probably damaging 1.00
IGL01296:Lama1 APN 17 68,052,046 (GRCm39) missense probably benign 0.27
IGL01317:Lama1 APN 17 68,125,696 (GRCm39) missense probably damaging 1.00
IGL01490:Lama1 APN 17 68,057,579 (GRCm39) missense possibly damaging 0.54
IGL01506:Lama1 APN 17 68,092,065 (GRCm39) missense probably benign 0.01
IGL01508:Lama1 APN 17 68,116,356 (GRCm39) splice site probably benign
IGL01522:Lama1 APN 17 68,059,769 (GRCm39) splice site probably benign
IGL01530:Lama1 APN 17 68,103,785 (GRCm39) missense probably benign 0.02
IGL01541:Lama1 APN 17 68,092,065 (GRCm39) missense probably benign 0.01
IGL01677:Lama1 APN 17 68,086,143 (GRCm39) missense probably benign 0.15
IGL01886:Lama1 APN 17 68,114,792 (GRCm39) missense probably benign 0.36
IGL01994:Lama1 APN 17 68,059,434 (GRCm39) missense probably benign 0.05
IGL02017:Lama1 APN 17 68,071,720 (GRCm39) missense probably benign 0.00
IGL02021:Lama1 APN 17 68,128,621 (GRCm39) missense probably damaging 1.00
IGL02026:Lama1 APN 17 68,116,287 (GRCm39) missense possibly damaging 0.82
IGL02044:Lama1 APN 17 68,118,485 (GRCm39) missense probably benign 0.01
IGL02120:Lama1 APN 17 68,023,784 (GRCm39) missense probably damaging 1.00
IGL02425:Lama1 APN 17 68,118,480 (GRCm39) missense probably benign 0.45
IGL02549:Lama1 APN 17 68,097,830 (GRCm39) missense possibly damaging 0.93
IGL02642:Lama1 APN 17 68,119,361 (GRCm39) missense probably benign 0.00
IGL02795:Lama1 APN 17 68,045,889 (GRCm39) splice site probably null
IGL02798:Lama1 APN 17 68,102,186 (GRCm39) splice site probably benign
IGL02863:Lama1 APN 17 68,111,531 (GRCm39) missense probably damaging 0.99
IGL02870:Lama1 APN 17 68,111,531 (GRCm39) missense probably damaging 0.99
IGL02876:Lama1 APN 17 68,057,687 (GRCm39) critical splice donor site probably null
IGL02885:Lama1 APN 17 68,111,531 (GRCm39) missense probably damaging 0.99
IGL02891:Lama1 APN 17 68,111,531 (GRCm39) missense probably damaging 0.99
IGL02978:Lama1 APN 17 68,093,076 (GRCm39) nonsense probably null
IGL03064:Lama1 APN 17 68,086,099 (GRCm39) missense probably benign 0.01
IGL03076:Lama1 APN 17 68,023,794 (GRCm39) missense possibly damaging 0.95
IGL03110:Lama1 APN 17 68,105,981 (GRCm39) missense probably benign 0.04
IGL03143:Lama1 APN 17 68,111,531 (GRCm39) missense probably damaging 0.99
IGL03159:Lama1 APN 17 68,111,531 (GRCm39) missense probably damaging 0.99
IGL03268:Lama1 APN 17 68,111,531 (GRCm39) missense probably damaging 0.99
ANU05:Lama1 UTSW 17 68,045,865 (GRCm39) missense probably damaging 1.00
PIT4472001:Lama1 UTSW 17 68,071,699 (GRCm39) missense
R0047:Lama1 UTSW 17 68,102,181 (GRCm39) splice site probably benign
R0047:Lama1 UTSW 17 68,102,181 (GRCm39) splice site probably benign
R0050:Lama1 UTSW 17 68,089,051 (GRCm39) missense possibly damaging 0.66
R0096:Lama1 UTSW 17 68,112,408 (GRCm39) missense probably benign 0.12
R0096:Lama1 UTSW 17 68,112,408 (GRCm39) missense probably benign 0.12
R0111:Lama1 UTSW 17 68,044,493 (GRCm39) missense probably damaging 0.98
R0116:Lama1 UTSW 17 68,083,918 (GRCm39) missense probably benign 0.10
R0121:Lama1 UTSW 17 68,105,508 (GRCm39) splice site probably benign
R0278:Lama1 UTSW 17 68,117,178 (GRCm39) missense probably null 0.98
R0281:Lama1 UTSW 17 68,124,564 (GRCm39) missense probably damaging 1.00
R0312:Lama1 UTSW 17 68,082,846 (GRCm39) missense possibly damaging 0.45
R0419:Lama1 UTSW 17 68,098,605 (GRCm39) critical splice donor site probably null
R0512:Lama1 UTSW 17 68,086,129 (GRCm39) missense possibly damaging 0.67
R0514:Lama1 UTSW 17 68,071,693 (GRCm39) missense probably benign 0.40
R0562:Lama1 UTSW 17 68,122,954 (GRCm39) missense probably damaging 1.00
R0632:Lama1 UTSW 17 68,059,363 (GRCm39) splice site probably benign
R0645:Lama1 UTSW 17 68,080,707 (GRCm39) missense probably benign 0.01
R0712:Lama1 UTSW 17 68,086,037 (GRCm39) splice site probably null
R0763:Lama1 UTSW 17 68,079,813 (GRCm39) missense probably damaging 0.97
R0941:Lama1 UTSW 17 68,082,860 (GRCm39) missense probably benign 0.10
R1025:Lama1 UTSW 17 68,059,893 (GRCm39) missense probably benign 0.00
R1084:Lama1 UTSW 17 68,111,464 (GRCm39) missense probably benign 0.12
R1103:Lama1 UTSW 17 68,097,942 (GRCm39) missense probably damaging 0.98
R1420:Lama1 UTSW 17 68,097,942 (GRCm39) missense probably damaging 0.98
R1430:Lama1 UTSW 17 68,089,150 (GRCm39) missense possibly damaging 0.95
R1569:Lama1 UTSW 17 68,087,613 (GRCm39) splice site probably null
R1575:Lama1 UTSW 17 68,117,404 (GRCm39) missense possibly damaging 0.96
R1613:Lama1 UTSW 17 68,114,918 (GRCm39) missense probably benign 0.42
R1620:Lama1 UTSW 17 68,074,028 (GRCm39) missense probably benign 0.01
R1629:Lama1 UTSW 17 68,112,423 (GRCm39) missense probably benign 0.00
R1645:Lama1 UTSW 17 68,044,677 (GRCm39) missense probably benign 0.14
R1652:Lama1 UTSW 17 68,114,841 (GRCm39) missense probably damaging 0.97
R1674:Lama1 UTSW 17 68,098,239 (GRCm39) missense probably benign
R1678:Lama1 UTSW 17 68,117,150 (GRCm39) missense possibly damaging 0.56
R1710:Lama1 UTSW 17 68,060,786 (GRCm39) missense probably benign 0.00
R1712:Lama1 UTSW 17 68,024,181 (GRCm39) missense possibly damaging 0.95
R1737:Lama1 UTSW 17 68,109,916 (GRCm39) missense probably benign 0.36
R1757:Lama1 UTSW 17 68,004,378 (GRCm39) missense unknown
R1757:Lama1 UTSW 17 68,070,831 (GRCm39) missense probably benign 0.40
R1813:Lama1 UTSW 17 68,098,218 (GRCm39) missense probably benign
R1896:Lama1 UTSW 17 68,098,218 (GRCm39) missense probably benign
R1945:Lama1 UTSW 17 68,052,848 (GRCm39) missense probably benign 0.14
R2086:Lama1 UTSW 17 68,124,618 (GRCm39) missense probably damaging 1.00
R2149:Lama1 UTSW 17 68,080,860 (GRCm39) missense possibly damaging 0.95
R2178:Lama1 UTSW 17 68,076,510 (GRCm39) missense probably benign 0.07
R2183:Lama1 UTSW 17 68,098,004 (GRCm39) missense probably damaging 0.98
R2197:Lama1 UTSW 17 68,059,936 (GRCm39) missense probably benign 0.02
R2213:Lama1 UTSW 17 68,084,029 (GRCm39) nonsense probably null
R2260:Lama1 UTSW 17 68,044,502 (GRCm39) missense probably damaging 0.96
R2356:Lama1 UTSW 17 68,117,109 (GRCm39) missense probably damaging 1.00
R2420:Lama1 UTSW 17 68,057,548 (GRCm39) missense probably benign 0.00
R2421:Lama1 UTSW 17 68,057,548 (GRCm39) missense probably benign 0.00
R2422:Lama1 UTSW 17 68,057,548 (GRCm39) missense probably benign 0.00
R2424:Lama1 UTSW 17 68,105,660 (GRCm39) missense probably benign 0.09
R2442:Lama1 UTSW 17 68,075,312 (GRCm39) missense probably benign 0.04
R3147:Lama1 UTSW 17 68,044,653 (GRCm39) missense probably damaging 0.98
R3414:Lama1 UTSW 17 68,044,598 (GRCm39) missense probably damaging 1.00
R3683:Lama1 UTSW 17 68,075,328 (GRCm39) missense probably benign 0.40
R3820:Lama1 UTSW 17 68,086,041 (GRCm39) splice site probably null
R3821:Lama1 UTSW 17 68,086,041 (GRCm39) splice site probably null
R3822:Lama1 UTSW 17 68,086,041 (GRCm39) splice site probably null
R4012:Lama1 UTSW 17 68,119,368 (GRCm39) nonsense probably null
R4113:Lama1 UTSW 17 68,071,698 (GRCm39) missense probably benign 0.01
R4133:Lama1 UTSW 17 68,119,481 (GRCm39) missense probably damaging 1.00
R4133:Lama1 UTSW 17 68,057,650 (GRCm39) missense probably damaging 0.98
R4259:Lama1 UTSW 17 68,059,413 (GRCm39) missense possibly damaging 0.95
R4278:Lama1 UTSW 17 68,098,512 (GRCm39) missense probably null 0.00
R4321:Lama1 UTSW 17 68,078,078 (GRCm39) missense probably benign 0.03
R4374:Lama1 UTSW 17 68,111,513 (GRCm39) missense probably benign 0.00
R4386:Lama1 UTSW 17 68,080,707 (GRCm39) missense probably benign 0.01
R4463:Lama1 UTSW 17 68,068,695 (GRCm39) missense probably damaging 1.00
R4629:Lama1 UTSW 17 68,112,355 (GRCm39) critical splice acceptor site probably null
R4630:Lama1 UTSW 17 68,101,295 (GRCm39) missense probably benign 0.00
R4633:Lama1 UTSW 17 68,105,579 (GRCm39) missense probably damaging 0.96
R4668:Lama1 UTSW 17 68,059,429 (GRCm39) missense probably benign 0.27
R4745:Lama1 UTSW 17 68,045,775 (GRCm39) missense probably damaging 1.00
R4786:Lama1 UTSW 17 68,080,854 (GRCm39) missense possibly damaging 0.77
R4797:Lama1 UTSW 17 68,023,770 (GRCm39) missense probably benign 0.04
R4803:Lama1 UTSW 17 68,116,266 (GRCm39) missense probably damaging 1.00
R4925:Lama1 UTSW 17 68,101,309 (GRCm39) missense probably benign 0.02
R4939:Lama1 UTSW 17 68,044,470 (GRCm39) missense possibly damaging 0.91
R4952:Lama1 UTSW 17 68,074,561 (GRCm39) critical splice donor site probably null
R4975:Lama1 UTSW 17 68,045,829 (GRCm39) missense possibly damaging 0.95
R4977:Lama1 UTSW 17 68,044,677 (GRCm39) missense probably damaging 1.00
R5039:Lama1 UTSW 17 68,052,888 (GRCm39) missense possibly damaging 0.66
R5047:Lama1 UTSW 17 68,050,276 (GRCm39) nonsense probably null
R5195:Lama1 UTSW 17 68,071,795 (GRCm39) missense probably benign 0.13
R5230:Lama1 UTSW 17 68,052,078 (GRCm39) nonsense probably null
R5236:Lama1 UTSW 17 68,111,487 (GRCm39) missense probably benign 0.24
R5254:Lama1 UTSW 17 68,063,711 (GRCm39) missense probably benign 0.01
R5345:Lama1 UTSW 17 68,124,558 (GRCm39) missense probably benign
R5438:Lama1 UTSW 17 68,107,769 (GRCm39) missense possibly damaging 0.92
R5521:Lama1 UTSW 17 68,087,889 (GRCm39) nonsense probably null
R5568:Lama1 UTSW 17 68,075,293 (GRCm39) critical splice acceptor site probably null
R5645:Lama1 UTSW 17 68,109,943 (GRCm39) missense probably damaging 1.00
R5665:Lama1 UTSW 17 68,077,982 (GRCm39) missense probably damaging 1.00
R5727:Lama1 UTSW 17 68,122,219 (GRCm39) missense possibly damaging 0.81
R5757:Lama1 UTSW 17 68,045,782 (GRCm39) missense possibly damaging 0.59
R5795:Lama1 UTSW 17 68,103,722 (GRCm39) missense probably benign 0.02
R5857:Lama1 UTSW 17 68,114,838 (GRCm39) missense probably damaging 0.99
R5894:Lama1 UTSW 17 68,086,042 (GRCm39) critical splice acceptor site probably null
R5974:Lama1 UTSW 17 68,080,722 (GRCm39) missense probably benign 0.31
R6032:Lama1 UTSW 17 68,057,638 (GRCm39) missense probably benign 0.01
R6032:Lama1 UTSW 17 68,057,638 (GRCm39) missense probably benign 0.01
R6120:Lama1 UTSW 17 68,087,612 (GRCm39) critical splice donor site probably null
R6219:Lama1 UTSW 17 68,097,851 (GRCm39) missense probably benign 0.08
R6224:Lama1 UTSW 17 68,109,982 (GRCm39) missense possibly damaging 0.56
R6249:Lama1 UTSW 17 68,105,599 (GRCm39) missense probably benign
R6265:Lama1 UTSW 17 68,057,650 (GRCm39) missense probably damaging 0.98
R6276:Lama1 UTSW 17 68,091,083 (GRCm39) splice site probably null
R6284:Lama1 UTSW 17 68,117,091 (GRCm39) missense probably damaging 0.99
R6337:Lama1 UTSW 17 68,093,014 (GRCm39) missense probably benign 0.27
R6414:Lama1 UTSW 17 68,053,905 (GRCm39) critical splice donor site probably null
R6631:Lama1 UTSW 17 68,081,477 (GRCm39) missense probably benign 0.21
R6659:Lama1 UTSW 17 68,125,630 (GRCm39) missense probably damaging 1.00
R6660:Lama1 UTSW 17 68,111,495 (GRCm39) missense probably benign 0.05
R6677:Lama1 UTSW 17 68,102,228 (GRCm39) missense probably benign 0.14
R6763:Lama1 UTSW 17 68,053,868 (GRCm39) missense unknown
R6787:Lama1 UTSW 17 68,091,020 (GRCm39) missense unknown
R6831:Lama1 UTSW 17 68,063,749 (GRCm39) missense possibly damaging 0.89
R6855:Lama1 UTSW 17 68,089,150 (GRCm39) missense possibly damaging 0.95
R6910:Lama1 UTSW 17 68,098,459 (GRCm39) missense possibly damaging 0.60
R6934:Lama1 UTSW 17 68,081,538 (GRCm39) missense probably benign 0.04
R6945:Lama1 UTSW 17 68,120,861 (GRCm39) missense
R6984:Lama1 UTSW 17 68,086,107 (GRCm39) missense
R6989:Lama1 UTSW 17 68,060,753 (GRCm39) missense
R6994:Lama1 UTSW 17 68,060,820 (GRCm39) missense
R6995:Lama1 UTSW 17 68,060,820 (GRCm39) missense
R7035:Lama1 UTSW 17 68,088,044 (GRCm39) missense
R7133:Lama1 UTSW 17 68,089,141 (GRCm39) missense
R7172:Lama1 UTSW 17 68,111,540 (GRCm39) missense
R7197:Lama1 UTSW 17 68,044,700 (GRCm39) nonsense probably null
R7217:Lama1 UTSW 17 68,071,668 (GRCm39) missense
R7229:Lama1 UTSW 17 68,059,441 (GRCm39) missense
R7264:Lama1 UTSW 17 68,050,292 (GRCm39) missense
R7311:Lama1 UTSW 17 68,074,380 (GRCm39) missense
R7394:Lama1 UTSW 17 68,024,256 (GRCm39) missense
R7419:Lama1 UTSW 17 68,024,169 (GRCm39) missense
R7460:Lama1 UTSW 17 68,074,013 (GRCm39) missense
R7492:Lama1 UTSW 17 68,124,646 (GRCm39) missense
R7494:Lama1 UTSW 17 68,118,441 (GRCm39) missense
R7552:Lama1 UTSW 17 68,044,662 (GRCm39) missense
R7576:Lama1 UTSW 17 68,089,036 (GRCm39) missense
R7583:Lama1 UTSW 17 68,068,616 (GRCm39) missense
R7649:Lama1 UTSW 17 68,044,549 (GRCm39) missense
R7663:Lama1 UTSW 17 68,087,875 (GRCm39) missense
R7667:Lama1 UTSW 17 68,087,592 (GRCm39) missense
R7688:Lama1 UTSW 17 68,068,623 (GRCm39) missense
R7693:Lama1 UTSW 17 68,124,026 (GRCm39) missense
R7748:Lama1 UTSW 17 68,057,585 (GRCm39) missense
R7778:Lama1 UTSW 17 68,111,468 (GRCm39) missense
R7824:Lama1 UTSW 17 68,111,468 (GRCm39) missense
R7861:Lama1 UTSW 17 68,116,216 (GRCm39) missense
R7884:Lama1 UTSW 17 68,076,430 (GRCm39) missense
R8029:Lama1 UTSW 17 68,124,589 (GRCm39) missense
R8078:Lama1 UTSW 17 68,098,289 (GRCm39) missense
R8101:Lama1 UTSW 17 68,052,917 (GRCm39) missense
R8313:Lama1 UTSW 17 68,057,515 (GRCm39) missense
R8356:Lama1 UTSW 17 68,044,491 (GRCm39) missense
R8366:Lama1 UTSW 17 68,125,699 (GRCm39) missense
R8403:Lama1 UTSW 17 68,052,918 (GRCm39) missense
R8456:Lama1 UTSW 17 68,044,491 (GRCm39) missense
R8466:Lama1 UTSW 17 68,120,948 (GRCm39) missense
R8678:Lama1 UTSW 17 68,124,098 (GRCm39) missense
R8728:Lama1 UTSW 17 68,125,663 (GRCm39) missense
R8796:Lama1 UTSW 17 68,117,146 (GRCm39) missense
R8885:Lama1 UTSW 17 68,080,779 (GRCm39) missense
R8893:Lama1 UTSW 17 68,112,367 (GRCm39) missense
R8898:Lama1 UTSW 17 68,128,610 (GRCm39) missense
R8909:Lama1 UTSW 17 68,079,736 (GRCm39) missense
R9025:Lama1 UTSW 17 68,119,491 (GRCm39) missense
R9045:Lama1 UTSW 17 68,060,838 (GRCm39) missense
R9098:Lama1 UTSW 17 68,111,508 (GRCm39) missense
R9114:Lama1 UTSW 17 68,128,669 (GRCm39) missense
R9173:Lama1 UTSW 17 68,076,597 (GRCm39) missense
R9190:Lama1 UTSW 17 68,111,514 (GRCm39) missense
R9381:Lama1 UTSW 17 68,044,479 (GRCm39) missense
R9429:Lama1 UTSW 17 68,118,449 (GRCm39) missense
R9504:Lama1 UTSW 17 68,128,661 (GRCm39) missense
R9558:Lama1 UTSW 17 68,124,004 (GRCm39) missense
R9647:Lama1 UTSW 17 68,024,170 (GRCm39) missense
R9651:Lama1 UTSW 17 68,101,215 (GRCm39) missense
R9654:Lama1 UTSW 17 68,101,266 (GRCm39) missense
R9710:Lama1 UTSW 17 68,129,404 (GRCm39) missense
R9733:Lama1 UTSW 17 68,116,940 (GRCm39) missense
RF001:Lama1 UTSW 17 68,059,897 (GRCm39) missense
RF013:Lama1 UTSW 17 68,088,057 (GRCm39) missense
V8831:Lama1 UTSW 17 68,059,878 (GRCm39) missense probably benign 0.00
X0024:Lama1 UTSW 17 68,045,883 (GRCm39) missense probably damaging 1.00
X0028:Lama1 UTSW 17 68,101,305 (GRCm39) missense probably benign 0.06
X0028:Lama1 UTSW 17 68,074,417 (GRCm39) missense probably benign 0.00
X0066:Lama1 UTSW 17 68,118,561 (GRCm39) missense probably damaging 1.00
Z1088:Lama1 UTSW 17 68,117,166 (GRCm39) missense probably damaging 1.00
Z1088:Lama1 UTSW 17 68,078,077 (GRCm39) missense probably benign 0.25
Z1088:Lama1 UTSW 17 68,059,878 (GRCm39) missense probably benign 0.00
Z1176:Lama1 UTSW 17 68,059,878 (GRCm39) missense probably benign 0.00
Z1177:Lama1 UTSW 17 68,059,878 (GRCm39) missense probably benign 0.00
Z1191:Lama1 UTSW 17 68,105,639 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- GGACAAACTAACTCCCAGTTGG -3'
(R):5'- TTAGAACTCTCTGTCAGCTGGC -3'

Sequencing Primer
(F):5'- CTGCCCCAGAGGAATAAT -3'
(R):5'- CTCTCTGTCAGCTGGCTGGAG -3'
Posted On 2015-10-21