Incidental Mutation 'R4684:Prkg1'
ID353574
Institutional Source Beutler Lab
Gene Symbol Prkg1
Ensembl Gene ENSMUSG00000052920
Gene Nameprotein kinase, cGMP-dependent, type I
SynonymsPrkgr1b, Prkg1b
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.635) question?
Stock #R4684 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location30567551-31765033 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 31664179 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 35 (K35*)
Ref Sequence ENSEMBL: ENSMUSP00000073268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065067] [ENSMUST00000073581]
Predicted Effect probably benign
Transcript: ENSMUST00000065067
SMART Domains Protein: ENSMUSP00000067576
Gene: ENSMUSG00000052920

DomainStartEndE-ValueType
coiled coil region 5 49 N/A INTRINSIC
cNMP 103 216 6.37e-27 SMART
cNMP 221 343 1.23e-33 SMART
S_TKc 360 619 5.25e-91 SMART
S_TK_X 620 671 1.55e-10 SMART
Predicted Effect probably null
Transcript: ENSMUST00000073581
AA Change: K35*
SMART Domains Protein: ENSMUSP00000073268
Gene: ENSMUSG00000052920
AA Change: K35*

DomainStartEndE-ValueType
coiled coil region 10 62 N/A INTRINSIC
cNMP 118 231 6.37e-27 SMART
cNMP 236 358 1.23e-33 SMART
S_TKc 375 634 5.25e-91 SMART
S_TK_X 635 686 1.55e-10 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammals have three different isoforms of cyclic GMP-dependent protein kinase (Ialpha, Ibeta, and II). These PRKG isoforms act as key mediators of the nitric oxide/cGMP signaling pathway and are important components of many signal transduction processes in diverse cell types. This PRKG1 gene on human chromosome 10 encodes the soluble Ialpha and Ibeta isoforms of PRKG by alternative transcript splicing. A separate gene on human chromosome 4, PRKG2, encodes the membrane-bound PRKG isoform II. The PRKG1 proteins play a central role in regulating cardiovascular and neuronal functions in addition to relaxing smooth muscle tone, preventing platelet aggregation, and modulating cell growth. This gene is most strongly expressed in all types of smooth muscle, platelets, cerebellar Purkinje cells, hippocampal neurons, and the lateral amygdala. Isoforms Ialpha and Ibeta have identical cGMP-binding and catalytic domains but differ in their leucine/isoleucine zipper and autoinhibitory sequences and therefore differ in their dimerization substrates and kinase enzyme activity. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mutant mice exhibit abnormal smooth muscle function and penile erectile deficiency. Conditional disruption in the hippocampus results in impaired LTP. Mice homozygous for a transposon induced allele exhibit postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310039H08Rik T C 17: 46,772,946 V45A probably benign Het
4921509C19Rik A G 2: 151,471,871 I629T unknown Het
4933402N03Rik T C 7: 131,138,684 R268G probably damaging Het
Abca13 A T 11: 9,434,193 R3882* probably null Het
Adamts3 T G 5: 89,703,007 T558P probably damaging Het
Ano2 A G 6: 125,790,341 N214S probably benign Het
Arhgef4 A T 1: 34,811,785 probably null Het
Boc C T 16: 44,500,380 A306T probably benign Het
Capn10 T C 1: 92,943,781 F367S probably damaging Het
Ccdc6 T C 10: 70,189,256 probably benign Het
Cobll1 G T 2: 65,099,028 S688R possibly damaging Het
Cpxm2 G T 7: 132,049,038 P631Q possibly damaging Het
Cyp2c68 A G 19: 39,699,335 V406A possibly damaging Het
Cyp4a30b T A 4: 115,455,003 Y118N probably damaging Het
Dgki A T 6: 37,299,846 probably benign Het
Disp2 A G 2: 118,792,756 N1323S probably damaging Het
Dock1 T A 7: 134,724,409 Y42* probably null Het
Eps8l1 C A 7: 4,473,945 P471Q probably damaging Het
Fam20a A C 11: 109,721,687 L10R unknown Het
Fpr-rs4 T A 17: 18,022,184 I151K probably damaging Het
Gga1 C A 15: 78,885,309 P161T probably damaging Het
Gm8909 A T 17: 36,165,858 H241Q possibly damaging Het
Gm9923 T A 10: 72,309,476 Y52* probably null Het
Gucy2g A G 19: 55,206,256 F910L probably damaging Het
Helz T C 11: 107,649,145 V315A probably damaging Het
Hk2 T C 6: 82,739,648 Y301C probably damaging Het
Htt C T 5: 34,852,765 P1521S probably damaging Het
Iah1 T C 12: 21,316,433 M1T probably null Het
Ik T C 18: 36,752,414 S287P probably damaging Het
Itga1 T A 13: 115,049,370 D32V probably damaging Het
Itpr2 A G 6: 146,373,173 F837S probably damaging Het
Klk14 A G 7: 43,691,968 I15V probably benign Het
Kng2 T C 16: 22,987,641 I603V possibly damaging Het
Lama1 T C 17: 67,773,778 I1267T possibly damaging Het
Lrp1b A C 2: 40,922,304 L2430V probably benign Het
Lrrn3 T G 12: 41,454,244 K25Q possibly damaging Het
Lta4h T A 10: 93,468,816 N233K probably benign Het
Mapk13 T C 17: 28,770,049 I53T probably damaging Het
Mdn1 T C 4: 32,666,430 F123L probably damaging Het
Mettl7b G T 10: 128,960,702 C79* probably null Het
Myh4 G C 11: 67,245,811 D472H probably damaging Het
Nipa2 A T 7: 55,935,826 N121K probably benign Het
Nostrin C T 2: 69,183,924 T408M probably benign Het
Olfr347 A G 2: 36,734,674 M118V probably damaging Het
Olfr725 T C 14: 50,034,830 D191G probably damaging Het
Oosp2 C T 19: 11,649,653 R102H probably damaging Het
Osgin2 T A 4: 16,001,946 I202L probably benign Het
Pbld2 C A 10: 63,057,697 R271S probably damaging Het
Pex6 C T 17: 46,712,101 T201I probably benign Het
Pilra T C 5: 137,835,515 I96M probably damaging Het
Pllp T A 8: 94,677,278 D47V possibly damaging Het
Plxna2 A G 1: 194,762,594 S765G probably benign Het
Prkca A T 11: 107,961,608 Y100N probably damaging Het
Psmc2 A G 5: 21,803,265 D389G possibly damaging Het
Rnf213 A G 11: 119,441,125 T2387A probably damaging Het
Ros1 T C 10: 52,129,096 N914S probably damaging Het
Ruvbl1 C A 6: 88,491,599 T367K probably benign Het
Scube2 C T 7: 109,810,713 R525H probably damaging Het
Sec14l4 T C 11: 4,035,200 probably null Het
Secisbp2l T C 2: 125,745,942 D751G probably damaging Het
Setd3 T C 12: 108,108,690 D402G probably benign Het
Slc15a2 T A 16: 36,757,849 K359N probably damaging Het
Slc25a21 A G 12: 57,196,936 S2P probably benign Het
Slfn8 A T 11: 83,017,506 H70Q probably benign Het
Spef2 T C 15: 9,647,490 I944V probably benign Het
Spg11 A G 2: 122,065,076 F1887S probably damaging Het
Sptbn4 T C 7: 27,364,419 E879G probably damaging Het
Sptbn4 A T 7: 27,366,735 D649E possibly damaging Het
Stx5a C A 19: 8,743,361 R121S probably damaging Het
Tbcd T C 11: 121,493,771 L26P probably damaging Het
Tecpr1 T C 5: 144,207,437 D649G probably benign Het
Tfam A G 10: 71,237,847 S32P probably benign Het
Trmt44 C T 5: 35,558,043 R642H probably benign Het
Trpm3 G A 19: 22,987,781 A1547T probably benign Het
Ttll6 T C 11: 96,153,177 V519A probably benign Het
Umodl1 T C 17: 30,998,114 F1107L probably benign Het
Usp5 A T 6: 124,817,956 V677E probably damaging Het
Utp20 A T 10: 88,807,445 L605* probably null Het
Utrn T C 10: 12,745,240 D229G probably damaging Het
Uty A T Y: 1,176,502 L178* probably null Het
Vmn2r88 A T 14: 51,413,334 D168V possibly damaging Het
Vps13b T C 15: 35,646,178 V1476A probably damaging Het
Vps13b C T 15: 35,841,341 H2506Y probably benign Het
Vps13b C A 15: 35,879,821 T3014K probably benign Het
Vps37c T C 19: 10,712,768 V198A probably benign Het
Zfc3h1 T C 10: 115,423,385 Y1621H probably benign Het
Zfp251 T C 15: 76,854,407 D162G possibly damaging Het
Zfp292 T C 4: 34,807,078 T1994A probably benign Het
Zfp791 A G 8: 85,110,930 Y102H probably benign Het
Other mutations in Prkg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Prkg1 APN 19 31302340 missense probably benign 0.02
IGL00481:Prkg1 APN 19 30571622 missense probably benign 0.28
IGL00517:Prkg1 APN 19 30894668 missense probably benign
IGL00782:Prkg1 APN 19 30578753 splice site probably benign
IGL01070:Prkg1 APN 19 30569343 splice site probably benign
IGL01106:Prkg1 APN 19 30585278 missense probably benign 0.05
IGL01783:Prkg1 APN 19 30624689 missense probably damaging 1.00
IGL02135:Prkg1 APN 19 30993076 missense probably benign 0.13
IGL02492:Prkg1 APN 19 30724202 missense probably damaging 1.00
IGL02543:Prkg1 APN 19 30624734 missense possibly damaging 0.62
IGL02733:Prkg1 APN 19 31302301 missense probably damaging 1.00
IGL03129:Prkg1 APN 19 30585281 nonsense probably null
IGL03220:Prkg1 APN 19 30569237 utr 3 prime probably benign
R0363:Prkg1 UTSW 19 31664196 missense probably damaging 1.00
R0693:Prkg1 UTSW 19 30594978 missense probably benign
R1099:Prkg1 UTSW 19 30571612 missense probably benign
R1464:Prkg1 UTSW 19 30578870 missense probably damaging 0.99
R1464:Prkg1 UTSW 19 30578870 missense probably damaging 0.99
R1556:Prkg1 UTSW 19 30624743 missense probably benign
R1738:Prkg1 UTSW 19 30786922 missense possibly damaging 0.48
R1974:Prkg1 UTSW 19 31585695 missense probably damaging 1.00
R2011:Prkg1 UTSW 19 31664142 missense possibly damaging 0.94
R2207:Prkg1 UTSW 19 30578860 missense probably damaging 1.00
R2270:Prkg1 UTSW 19 30578631 missense probably benign 0.27
R3009:Prkg1 UTSW 19 31664112 missense possibly damaging 0.74
R4078:Prkg1 UTSW 19 31585578 missense probably damaging 1.00
R4355:Prkg1 UTSW 19 30569229 utr 3 prime probably benign
R4652:Prkg1 UTSW 19 30595012 missense probably damaging 1.00
R4669:Prkg1 UTSW 19 31664239 missense probably damaging 0.98
R4789:Prkg1 UTSW 19 31585645 missense probably damaging 0.97
R4826:Prkg1 UTSW 19 31764606 missense possibly damaging 0.93
R4936:Prkg1 UTSW 19 30586375 missense probably benign 0.37
R5625:Prkg1 UTSW 19 31764762 missense possibly damaging 0.95
R5819:Prkg1 UTSW 19 31585672 missense probably benign 0.02
R5855:Prkg1 UTSW 19 30894694 missense possibly damaging 0.93
R5882:Prkg1 UTSW 19 31585697 missense probably damaging 1.00
R5965:Prkg1 UTSW 19 30724156 splice site probably null
R5968:Prkg1 UTSW 19 30592924 missense probably damaging 1.00
R6310:Prkg1 UTSW 19 30569251 missense probably damaging 1.00
R6433:Prkg1 UTSW 19 30781346 missense probably benign 0.21
R6702:Prkg1 UTSW 19 30993084 missense probably benign 0.00
R6750:Prkg1 UTSW 19 31764561 missense probably benign 0.41
R6894:Prkg1 UTSW 19 30624774 nonsense probably null
R7155:Prkg1 UTSW 19 31302301 missense probably damaging 1.00
R7165:Prkg1 UTSW 19 30585199 missense probably damaging 1.00
R7238:Prkg1 UTSW 19 30624690 missense probably damaging 1.00
R7428:Prkg1 UTSW 19 30578835 missense probably damaging 1.00
R7748:Prkg1 UTSW 19 30993091 missense possibly damaging 0.90
R7804:Prkg1 UTSW 19 30578632 missense probably benign 0.00
R7804:Prkg1 UTSW 19 30624770 missense possibly damaging 0.92
R7893:Prkg1 UTSW 19 30586367 missense probably damaging 0.99
R8304:Prkg1 UTSW 19 30724184 missense possibly damaging 0.75
X0011:Prkg1 UTSW 19 30993121 missense probably damaging 1.00
Z1177:Prkg1 UTSW 19 31302373 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CTGAGATCCTGGATGTCGAAG -3'
(R):5'- CTCAAGTCGAGGGAAGCTTTTG -3'

Sequencing Primer
(F):5'- ATGTCGAAGGCGGTGGGC -3'
(R):5'- TTTTGCACTCGCGAGGCAG -3'
Posted On2015-10-21