Incidental Mutation 'R4685:Bmf'
ID353587
Institutional Source Beutler Lab
Gene Symbol Bmf
Ensembl Gene ENSMUSG00000040093
Gene NameBCL2 modifying factor
Synonyms
MMRRC Submission 041936-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R4685 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location118528757-118549687 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 118546802 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 74 (A74V)
Ref Sequence ENSEMBL: ENSMUSP00000106483 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090219] [ENSMUST00000110859]
Predicted Effect probably damaging
Transcript: ENSMUST00000090219
AA Change: A155V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000087686
Gene: ENSMUSG00000040093
AA Change: A155V

DomainStartEndE-ValueType
low complexity region 24 36 N/A INTRINSIC
Pfam:BMF 84 270 1.9e-69 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110859
AA Change: A74V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106483
Gene: ENSMUSG00000040093
AA Change: A74V

DomainStartEndE-ValueType
Pfam:BMF 7 190 1.9e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125860
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138342
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143583
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146962
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152123
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154521
Meta Mutation Damage Score 0.292 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the BCL2 protein family. BCL2 family members form hetero- or homodimers and act as anti- or pro-apoptotic regulators that are involved in a wide variety of cellular activities. This protein contains a single BCL2 homology domain 3 (BH3), and has been shown to bind BCL2 proteins and function as an apoptotic activator. This protein is found to be sequestered to myosin V motors by its association with dynein light chain 2, which may be important for sensing intracellular damage and triggering apoptosis. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted knockout mutations show enlarged spleen, increased B cells and CD8-positive T cells, decreased B cells and T cells apoptosis, vagina atresia and hydrometrocolpos. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004P03Rik T C 12: 17,007,184 D104G probably damaging Het
2810021J22Rik T C 11: 58,880,924 S411P probably damaging Het
Adcy2 T C 13: 68,727,905 R493G probably benign Het
Adcy8 A G 15: 64,737,438 I874T probably benign Het
Ano2 G T 6: 125,980,124 E619* probably null Het
Apob A G 12: 8,006,456 K1613R probably benign Het
Arhgef10 T A 8: 14,956,963 F476Y probably damaging Het
Cadps T C 14: 12,467,139 E925G possibly damaging Het
Ccdc162 T C 10: 41,681,686 D181G possibly damaging Het
Ccdc85c A T 12: 108,207,175 C387S probably benign Het
Cntnap5a T C 1: 116,446,680 V974A possibly damaging Het
Dnah7b T C 1: 46,211,328 F1703S probably damaging Het
Dsg3 C A 18: 20,539,736 D821E probably benign Het
Ecel1 G T 1: 87,152,946 probably null Het
Edn1 A T 13: 42,305,253 probably null Het
Egfr G A 11: 16,858,980 C58Y probably damaging Het
Fam184a T C 10: 53,698,500 N282D probably benign Het
Fhit T A 14: 9,870,091 Q63L probably damaging Het
Gabarapl2 T C 8: 111,942,518 V36A probably benign Het
Glis1 T C 4: 107,567,645 V151A probably benign Het
Gm12695 A G 4: 96,761,980 S210P probably damaging Het
Gpat4 TAGAAGA TAGA 8: 23,182,849 probably benign Het
H2-M10.4 G A 17: 36,461,796 A98V probably benign Het
Hhat C A 1: 192,595,054 G366C probably damaging Het
Hydin C A 8: 110,462,522 A1186E probably damaging Het
Itgb2 T A 10: 77,550,103 probably null Het
Kank1 C T 19: 25,410,034 A329V possibly damaging Het
Kdm4b T A 17: 56,401,675 S1070T probably benign Het
Kyat1 A G 2: 30,188,265 Y101H probably damaging Het
Lman1l T A 9: 57,609,200 I407F probably damaging Het
Map4k5 T C 12: 69,811,366 K679R probably benign Het
Mill1 A T 7: 18,255,928 D45V probably damaging Het
Myo3a T A 2: 22,407,422 Y743N probably damaging Het
Nox4 C G 7: 87,297,508 I137M probably benign Het
Odf4 A G 11: 68,922,839 probably null Het
Ostf1 A T 19: 18,581,288 D210E probably damaging Het
Paxip1 A T 5: 27,761,677 probably null Het
Pitrm1 A G 13: 6,556,542 T211A probably benign Het
Pla2g4f A G 2: 120,305,015 S393P probably damaging Het
Plppr3 T C 10: 79,867,525 T42A probably damaging Het
Plxna4 C A 6: 32,165,844 G1559W probably damaging Het
Ppp1r13l T C 7: 19,375,383 probably null Het
Prex1 C T 2: 166,638,332 V163M probably damaging Het
Prl6a1 A G 13: 27,316,324 T93A probably benign Het
Psg16 T C 7: 17,090,534 V81A probably benign Het
Rbm33 A T 5: 28,408,282 probably benign Het
Rest C T 5: 77,275,243 P298L possibly damaging Het
Rhobtb3 G A 13: 75,878,932 R441* probably null Het
Rims4 T A 2: 163,864,994 K155* probably null Het
Rps6kb1 C T 11: 86,519,887 probably null Het
Ryr2 T C 13: 11,692,646 D2835G probably damaging Het
Sc5d C T 9: 42,258,650 V92I probably benign Het
Sell A T 1: 164,066,260 I175F probably damaging Het
Serpinb6d A G 13: 33,671,228 D295G probably damaging Het
Sphk1 A G 11: 116,535,280 D96G probably damaging Het
Spns3 A T 11: 72,537,270 V228D probably damaging Het
Sspo A G 6: 48,492,894 S4500G probably damaging Het
Syt9 T A 7: 107,436,471 C232S possibly damaging Het
Terf1 A G 1: 15,818,961 I176V possibly damaging Het
Tln2 C T 9: 67,302,572 A428T probably damaging Het
Tmprss7 T C 16: 45,679,348 N321S probably benign Het
Tomm40 A G 7: 19,701,836 I323T probably benign Het
Try5 T A 6: 41,311,299 Q240L possibly damaging Het
Vmn1r213 A T 13: 23,011,630 I128L probably benign Het
Vmn2r80 T C 10: 79,194,328 F663L possibly damaging Het
Znfx1 T A 2: 167,039,030 Y278F probably damaging Het
Zpbp2 A G 11: 98,551,291 probably benign Het
Other mutations in Bmf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01610:Bmf APN 2 118549158 missense probably benign 0.00
R0009:Bmf UTSW 2 118549622 missense probably damaging 0.98
R4180:Bmf UTSW 2 118532537 utr 3 prime probably benign
R4598:Bmf UTSW 2 118549128 missense probably benign 0.00
R5883:Bmf UTSW 2 118546966 synonymous silent
R5921:Bmf UTSW 2 118532553 utr 3 prime probably benign
Predicted Primers PCR Primer
(F):5'- CCCTGGCTGTTCAGTTTGAG -3'
(R):5'- TCTCTGACAGGAGAGATGGAGC -3'

Sequencing Primer
(F):5'- CTGTTCAGTTTGAGGAAGGAAATAG -3'
(R):5'- AGATGGAGCCACCTCAGTGTG -3'
Posted On2015-10-21