Incidental Mutation 'R4685:Gm12695'
ID353592
Institutional Source Beutler Lab
Gene Symbol Gm12695
Ensembl Gene ENSMUSG00000078639
Gene Namepredicted gene 12695
Synonyms
MMRRC Submission 041936-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R4685 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location96723647-96785186 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 96761980 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 210 (S210P)
Ref Sequence ENSEMBL: ENSMUSP00000102686 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107071]
Predicted Effect probably damaging
Transcript: ENSMUST00000107071
AA Change: S210P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102686
Gene: ENSMUSG00000078639
AA Change: S210P

DomainStartEndE-ValueType
low complexity region 226 237 N/A INTRINSIC
low complexity region 360 371 N/A INTRINSIC
Meta Mutation Damage Score 0.0874 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 97% (71/73)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004P03Rik T C 12: 17,007,184 D104G probably damaging Het
2810021J22Rik T C 11: 58,880,924 S411P probably damaging Het
Adcy2 T C 13: 68,727,905 R493G probably benign Het
Adcy8 A G 15: 64,737,438 I874T probably benign Het
Ano2 G T 6: 125,980,124 E619* probably null Het
Apob A G 12: 8,006,456 K1613R probably benign Het
Arhgef10 T A 8: 14,956,963 F476Y probably damaging Het
Bmf G A 2: 118,546,802 A74V probably damaging Het
Cadps T C 14: 12,467,139 E925G possibly damaging Het
Ccdc162 T C 10: 41,681,686 D181G possibly damaging Het
Ccdc85c A T 12: 108,207,175 C387S probably benign Het
Cntnap5a T C 1: 116,446,680 V974A possibly damaging Het
Dnah7b T C 1: 46,211,328 F1703S probably damaging Het
Dsg3 C A 18: 20,539,736 D821E probably benign Het
Ecel1 G T 1: 87,152,946 probably null Het
Edn1 A T 13: 42,305,253 probably null Het
Egfr G A 11: 16,858,980 C58Y probably damaging Het
Fam184a T C 10: 53,698,500 N282D probably benign Het
Fhit T A 14: 9,870,091 Q63L probably damaging Het
Gabarapl2 T C 8: 111,942,518 V36A probably benign Het
Glis1 T C 4: 107,567,645 V151A probably benign Het
Gpat4 TAGAAGA TAGA 8: 23,182,849 probably benign Het
H2-M10.4 G A 17: 36,461,796 A98V probably benign Het
Hhat C A 1: 192,595,054 G366C probably damaging Het
Hydin C A 8: 110,462,522 A1186E probably damaging Het
Itgb2 T A 10: 77,550,103 probably null Het
Kank1 C T 19: 25,410,034 A329V possibly damaging Het
Kdm4b T A 17: 56,401,675 S1070T probably benign Het
Kyat1 A G 2: 30,188,265 Y101H probably damaging Het
Lman1l T A 9: 57,609,200 I407F probably damaging Het
Map4k5 T C 12: 69,811,366 K679R probably benign Het
Mill1 A T 7: 18,255,928 D45V probably damaging Het
Myo3a T A 2: 22,407,422 Y743N probably damaging Het
Nox4 C G 7: 87,297,508 I137M probably benign Het
Odf4 A G 11: 68,922,839 probably null Het
Ostf1 A T 19: 18,581,288 D210E probably damaging Het
Paxip1 A T 5: 27,761,677 probably null Het
Pitrm1 A G 13: 6,556,542 T211A probably benign Het
Pla2g4f A G 2: 120,305,015 S393P probably damaging Het
Plppr3 T C 10: 79,867,525 T42A probably damaging Het
Plxna4 C A 6: 32,165,844 G1559W probably damaging Het
Ppp1r13l T C 7: 19,375,383 probably null Het
Prex1 C T 2: 166,638,332 V163M probably damaging Het
Prl6a1 A G 13: 27,316,324 T93A probably benign Het
Psg16 T C 7: 17,090,534 V81A probably benign Het
Rbm33 A T 5: 28,408,282 probably benign Het
Rest C T 5: 77,275,243 P298L possibly damaging Het
Rhobtb3 G A 13: 75,878,932 R441* probably null Het
Rims4 T A 2: 163,864,994 K155* probably null Het
Rps6kb1 C T 11: 86,519,887 probably null Het
Ryr2 T C 13: 11,692,646 D2835G probably damaging Het
Sc5d C T 9: 42,258,650 V92I probably benign Het
Sell A T 1: 164,066,260 I175F probably damaging Het
Serpinb6d A G 13: 33,671,228 D295G probably damaging Het
Sphk1 A G 11: 116,535,280 D96G probably damaging Het
Spns3 A T 11: 72,537,270 V228D probably damaging Het
Sspo A G 6: 48,492,894 S4500G probably damaging Het
Syt9 T A 7: 107,436,471 C232S possibly damaging Het
Terf1 A G 1: 15,818,961 I176V possibly damaging Het
Tln2 C T 9: 67,302,572 A428T probably damaging Het
Tmprss7 T C 16: 45,679,348 N321S probably benign Het
Tomm40 A G 7: 19,701,836 I323T probably benign Het
Try5 T A 6: 41,311,299 Q240L possibly damaging Het
Vmn1r213 A T 13: 23,011,630 I128L probably benign Het
Vmn2r80 T C 10: 79,194,328 F663L possibly damaging Het
Znfx1 T A 2: 167,039,030 Y278F probably damaging Het
Zpbp2 A G 11: 98,551,291 probably benign Het
Other mutations in Gm12695
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Gm12695 APN 4 96749182 missense probably damaging 1.00
IGL01016:Gm12695 APN 4 96757947 missense probably benign 0.03
IGL02605:Gm12695 APN 4 96762751 missense probably null 0.92
IGL02734:Gm12695 APN 4 96724030 nonsense probably null
IGL02869:Gm12695 APN 4 96762133 splice site probably benign
IGL02895:Gm12695 APN 4 96723949 missense probably damaging 0.99
R0020:Gm12695 UTSW 4 96769735 missense probably damaging 0.96
R0465:Gm12695 UTSW 4 96785075 missense probably damaging 1.00
R0941:Gm12695 UTSW 4 96728217 nonsense probably null
R0968:Gm12695 UTSW 4 96762066 missense probably damaging 1.00
R1965:Gm12695 UTSW 4 96762845 missense probably benign 0.16
R1983:Gm12695 UTSW 4 96738977 missense possibly damaging 0.84
R2051:Gm12695 UTSW 4 96769771 missense probably damaging 0.99
R2063:Gm12695 UTSW 4 96769726 missense probably benign 0.14
R2064:Gm12695 UTSW 4 96769726 missense probably benign 0.14
R2065:Gm12695 UTSW 4 96769726 missense probably benign 0.14
R2066:Gm12695 UTSW 4 96769726 missense probably benign 0.14
R2067:Gm12695 UTSW 4 96769726 missense probably benign 0.14
R2073:Gm12695 UTSW 4 96723945 missense possibly damaging 0.76
R2075:Gm12695 UTSW 4 96723945 missense possibly damaging 0.76
R2233:Gm12695 UTSW 4 96724029 missense probably damaging 1.00
R2234:Gm12695 UTSW 4 96724029 missense probably damaging 1.00
R2327:Gm12695 UTSW 4 96769656 missense probably benign 0.00
R2507:Gm12695 UTSW 4 96754189 missense probably damaging 0.99
R3836:Gm12695 UTSW 4 96762097 missense probably damaging 0.99
R5491:Gm12695 UTSW 4 96769668 missense possibly damaging 0.84
R5792:Gm12695 UTSW 4 96728283 missense probably benign 0.00
R6767:Gm12695 UTSW 4 96762696 intron probably null
R6786:Gm12695 UTSW 4 96762821 missense probably damaging 1.00
R6874:Gm12695 UTSW 4 96785069 missense probably benign 0.04
R6923:Gm12695 UTSW 4 96769816 missense probably benign 0.00
R6978:Gm12695 UTSW 4 96769722 missense possibly damaging 0.69
R7810:Gm12695 UTSW 4 96731371 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCCACAGAAAAGGCCTTGG -3'
(R):5'- CATGTCTTCGCTCAGAGCTC -3'

Sequencing Primer
(F):5'- CTTGGTCAAGGGAGAAACTAACTTC -3'
(R):5'- CGCTCAGAGCTCTTCTCAC -3'
Posted On2015-10-21