Incidental Mutation 'R4685:Dsg3'
ID353645
Institutional Source Beutler Lab
Gene Symbol Dsg3
Ensembl Gene ENSMUSG00000056632
Gene Namedesmoglein 3
Synonyms
MMRRC Submission 041936-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.333) question?
Stock #R4685 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location20510304-20541310 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 20539736 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 821 (D821E)
Ref Sequence ENSEMBL: ENSMUSP00000064718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070892]
Predicted Effect probably benign
Transcript: ENSMUST00000070892
AA Change: D821E

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000064718
Gene: ENSMUSG00000056632
AA Change: D821E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 70 155 3.9e-13 SMART
CA 179 265 2.36e-21 SMART
CA 288 382 1.55e-7 SMART
CA 409 493 6.15e-11 SMART
low complexity region 615 638 N/A INTRINSIC
low complexity region 643 657 N/A INTRINSIC
low complexity region 725 736 N/A INTRINSIC
Meta Mutation Damage Score 0.0759 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Mice lacking the encoded protein exhibit loss of keratinocyte cell adhesion resulting in a phenotype that resembles that of patients with pemphigus vulgaris. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutants display runting from decreased food intake due to oropharyngeal epithelial lesions, blisters around snout and eyes, hair loss by weaning, and hair regrowth with bald patches throughout life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004P03Rik T C 12: 17,007,184 D104G probably damaging Het
2810021J22Rik T C 11: 58,880,924 S411P probably damaging Het
Adcy2 T C 13: 68,727,905 R493G probably benign Het
Adcy8 A G 15: 64,737,438 I874T probably benign Het
Ano2 G T 6: 125,980,124 E619* probably null Het
Apob A G 12: 8,006,456 K1613R probably benign Het
Arhgef10 T A 8: 14,956,963 F476Y probably damaging Het
Bmf G A 2: 118,546,802 A74V probably damaging Het
Cadps T C 14: 12,467,139 E925G possibly damaging Het
Ccdc162 T C 10: 41,681,686 D181G possibly damaging Het
Ccdc85c A T 12: 108,207,175 C387S probably benign Het
Cntnap5a T C 1: 116,446,680 V974A possibly damaging Het
Dnah7b T C 1: 46,211,328 F1703S probably damaging Het
Ecel1 G T 1: 87,152,946 probably null Het
Edn1 A T 13: 42,305,253 probably null Het
Egfr G A 11: 16,858,980 C58Y probably damaging Het
Fam184a T C 10: 53,698,500 N282D probably benign Het
Fhit T A 14: 9,870,091 Q63L probably damaging Het
Gabarapl2 T C 8: 111,942,518 V36A probably benign Het
Glis1 T C 4: 107,567,645 V151A probably benign Het
Gm12695 A G 4: 96,761,980 S210P probably damaging Het
Gpat4 TAGAAGA TAGA 8: 23,182,849 probably benign Het
H2-M10.4 G A 17: 36,461,796 A98V probably benign Het
Hhat C A 1: 192,595,054 G366C probably damaging Het
Hydin C A 8: 110,462,522 A1186E probably damaging Het
Itgb2 T A 10: 77,550,103 probably null Het
Kank1 C T 19: 25,410,034 A329V possibly damaging Het
Kdm4b T A 17: 56,401,675 S1070T probably benign Het
Kyat1 A G 2: 30,188,265 Y101H probably damaging Het
Lman1l T A 9: 57,609,200 I407F probably damaging Het
Map4k5 T C 12: 69,811,366 K679R probably benign Het
Mill1 A T 7: 18,255,928 D45V probably damaging Het
Myo3a T A 2: 22,407,422 Y743N probably damaging Het
Nox4 C G 7: 87,297,508 I137M probably benign Het
Odf4 A G 11: 68,922,839 probably null Het
Ostf1 A T 19: 18,581,288 D210E probably damaging Het
Paxip1 A T 5: 27,761,677 probably null Het
Pitrm1 A G 13: 6,556,542 T211A probably benign Het
Pla2g4f A G 2: 120,305,015 S393P probably damaging Het
Plppr3 T C 10: 79,867,525 T42A probably damaging Het
Plxna4 C A 6: 32,165,844 G1559W probably damaging Het
Ppp1r13l T C 7: 19,375,383 probably null Het
Prex1 C T 2: 166,638,332 V163M probably damaging Het
Prl6a1 A G 13: 27,316,324 T93A probably benign Het
Psg16 T C 7: 17,090,534 V81A probably benign Het
Rbm33 A T 5: 28,408,282 probably benign Het
Rest C T 5: 77,275,243 P298L possibly damaging Het
Rhobtb3 G A 13: 75,878,932 R441* probably null Het
Rims4 T A 2: 163,864,994 K155* probably null Het
Rps6kb1 C T 11: 86,519,887 probably null Het
Ryr2 T C 13: 11,692,646 D2835G probably damaging Het
Sc5d C T 9: 42,258,650 V92I probably benign Het
Sell A T 1: 164,066,260 I175F probably damaging Het
Serpinb6d A G 13: 33,671,228 D295G probably damaging Het
Sphk1 A G 11: 116,535,280 D96G probably damaging Het
Spns3 A T 11: 72,537,270 V228D probably damaging Het
Sspo A G 6: 48,492,894 S4500G probably damaging Het
Syt9 T A 7: 107,436,471 C232S possibly damaging Het
Terf1 A G 1: 15,818,961 I176V possibly damaging Het
Tln2 C T 9: 67,302,572 A428T probably damaging Het
Tmprss7 T C 16: 45,679,348 N321S probably benign Het
Tomm40 A G 7: 19,701,836 I323T probably benign Het
Try5 T A 6: 41,311,299 Q240L possibly damaging Het
Vmn1r213 A T 13: 23,011,630 I128L probably benign Het
Vmn2r80 T C 10: 79,194,328 F663L possibly damaging Het
Znfx1 T A 2: 167,039,030 Y278F probably damaging Het
Zpbp2 A G 11: 98,551,291 probably benign Het
Other mutations in Dsg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Dsg3 APN 18 20539654 missense probably damaging 1.00
IGL00697:Dsg3 APN 18 20524689 critical splice donor site probably null
IGL00966:Dsg3 APN 18 20523607 missense probably benign 0.02
IGL01352:Dsg3 APN 18 20523696 missense probably benign 0.25
IGL01953:Dsg3 APN 18 20525304 missense probably damaging 1.00
IGL02385:Dsg3 APN 18 20527714 missense probably damaging 1.00
IGL02622:Dsg3 APN 18 20528947 splice site probably benign
IGL02643:Dsg3 APN 18 20528955 missense probably benign 0.00
IGL02740:Dsg3 APN 18 20527708 missense possibly damaging 0.93
IGL03012:Dsg3 APN 18 20537243 critical splice acceptor site probably null
IGL03026:Dsg3 APN 18 20536972 splice site probably null
IGL03063:Dsg3 APN 18 20533368 splice site probably benign
IGL03098:Dsg3 APN 18 20510365 utr 5 prime probably benign
IGL03132:Dsg3 APN 18 20524596 missense probably damaging 1.00
IGL03352:Dsg3 APN 18 20527632 missense probably benign
P0035:Dsg3 UTSW 18 20539969 missense probably benign 0.05
R0039:Dsg3 UTSW 18 20521484 missense probably benign 0.36
R0099:Dsg3 UTSW 18 20540022 missense probably benign 0.01
R0109:Dsg3 UTSW 18 20540134 missense probably damaging 0.96
R0109:Dsg3 UTSW 18 20540134 missense probably damaging 0.96
R0143:Dsg3 UTSW 18 20536825 missense probably damaging 1.00
R0194:Dsg3 UTSW 18 20540142 missense probably damaging 1.00
R0373:Dsg3 UTSW 18 20539747 missense probably damaging 1.00
R0517:Dsg3 UTSW 18 20529025 missense probably benign 0.06
R0521:Dsg3 UTSW 18 20527815 missense possibly damaging 0.53
R1194:Dsg3 UTSW 18 20525220 missense probably damaging 0.98
R1551:Dsg3 UTSW 18 20536918 missense possibly damaging 0.84
R1762:Dsg3 UTSW 18 20539732 missense probably damaging 1.00
R1957:Dsg3 UTSW 18 20522105 missense probably damaging 1.00
R2061:Dsg3 UTSW 18 20527737 nonsense probably null
R2071:Dsg3 UTSW 18 20536825 missense probably damaging 1.00
R2513:Dsg3 UTSW 18 20523662 missense possibly damaging 0.48
R2571:Dsg3 UTSW 18 20540005 missense probably benign 0.01
R2945:Dsg3 UTSW 18 20539935 missense probably benign
R2968:Dsg3 UTSW 18 20525225 missense possibly damaging 0.75
R3906:Dsg3 UTSW 18 20538499 missense probably damaging 1.00
R4616:Dsg3 UTSW 18 20531559 missense probably benign
R4641:Dsg3 UTSW 18 20520558 missense probably benign 0.28
R5690:Dsg3 UTSW 18 20522051 missense probably benign 0.01
R5786:Dsg3 UTSW 18 20521571 missense possibly damaging 0.46
R5950:Dsg3 UTSW 18 20538529 missense probably damaging 1.00
R6131:Dsg3 UTSW 18 20538512 missense probably damaging 0.99
R6131:Dsg3 UTSW 18 20520477 splice site probably null
R6243:Dsg3 UTSW 18 20539724 missense probably damaging 1.00
R6315:Dsg3 UTSW 18 20524586 missense probably benign 0.08
R6327:Dsg3 UTSW 18 20539870 missense probably benign
R6418:Dsg3 UTSW 18 20523760 critical splice donor site probably null
R6464:Dsg3 UTSW 18 20533526 missense probably benign 0.00
R6497:Dsg3 UTSW 18 20537248 missense probably benign 0.33
R6518:Dsg3 UTSW 18 20533422 missense probably benign 0.23
R6551:Dsg3 UTSW 18 20539911 missense unknown
R6685:Dsg3 UTSW 18 20520615 critical splice donor site probably null
R6952:Dsg3 UTSW 18 20525159 missense possibly damaging 0.77
R7357:Dsg3 UTSW 18 20539783 missense probably damaging 1.00
R7385:Dsg3 UTSW 18 20540197 missense possibly damaging 0.52
R7456:Dsg3 UTSW 18 20531363 missense probably benign 0.17
R7506:Dsg3 UTSW 18 20533464 missense probably benign 0.31
R7570:Dsg3 UTSW 18 20527780 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GCCTTGGGCTTTATGAACAGG -3'
(R):5'- TTCCAGACTGCCAGGCAAAG -3'

Sequencing Primer
(F):5'- ATGGGTTTATAAGGTCCTTTTCTCC -3'
(R):5'- AGTCTGGTACCTGTTAGAACCTGAC -3'
Posted On2015-10-21