Mutagenetix > Incidental Mutation

Incidental Mutation 'R4686:Adamtsl2'

353651

Institutional Source

Beutler Lab

Gene Symbol

Adamtsl2

Ensembl Gene

ENSMUSG00000036040

Gene Name

ADAMTS-like 2

Synonyms

A930008K15Rik

MMRRC Submission

041937-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4686 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

27079379-27108981 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 27093825 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 411 (N411S)

Ref Sequence

ENSEMBL: ENSMUSP00000088774 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091233]

AlphaFold

Q7TSK7

Predicted Effect

probably damaging
Transcript: ENSMUST00000091233
AA Change: N411S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000088774
Gene: ENSMUSG00000036040
AA Change: N411S

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
TSP1	50	106	5.14e-7	SMART
Pfam:ADAM_spacer1	214	331	5.4e-28	PFAM
low complexity region	345	358	N/A	INTRINSIC
TSP1	573	629	8.15e-1	SMART
TSP1	631	692	1.85e-2	SMART
TSP1	694	744	4.15e-1	SMART
TSP1	747	796	9.98e-5	SMART
TSP1	803	861	4.95e-2	SMART
TSP1	863	914	2.53e-6	SMART
Pfam:PLAC	922	953	1.4e-12	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143246

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000169787

Meta Mutation Damage Score

0.0730

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 95.0%

Validation Efficiency

97% (68/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) and ADAMTS-like protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The protein encoded by this gene lacks the protease domain, and is therefore of a member of the the ADAMTS-like protein subfamily. It is a secreted glycoprotein that binds the cell surface and extracellular matrix; it also interacts with latent transforming growth factor beta binding protein 1. Mutations in this gene have been associated with geleophysic dysplasia. [provided by RefSeq, Feb 2009]
PHENOTYPE: Homozygous null mice die shortly after birth, are cyanotic and exhibit respiratory distress. Severe bronchial epithelial dysplasia with abnormal glycogen-rich inclusions in the bronchial epithelium is observed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adnp	A	C	2: 168,182,389	C995W	possibly damaging	Het
Akap6	CA	C	12: 52,887,623		probably null	Het
Ano2	T	G	6: 125,790,291	I228M	probably benign	Het
Arhgap21	T	C	2: 20,863,222	D830G	probably damaging	Het
Atp13a2	G	A	4: 141,003,276		probably null	Het
Ccdc175	C	T	12: 72,112,278	S629N	probably damaging	Het
Cdhr4	T	C	9: 107,995,684	W311R	probably benign	Het
Chaf1b	A	G	16: 93,884,584	H30R	probably benign	Het
Clnk	G	A	5: 38,741,837		probably benign	Het
Copb1	A	G	7: 114,221,736	S773P	possibly damaging	Het
Cse1l	A	G	2: 166,932,160	D198G	probably damaging	Het
Ears2	A	G	7: 122,048,204	S286P	probably damaging	Het
Efcab7	A	G	4: 99,878,116	E114G	probably benign	Het
Fanca	G	C	8: 123,268,934		probably benign	Het
Flt3	A	G	5: 147,377,048	L64P	probably damaging	Het
Gabrb1	A	G	5: 71,700,022	T3A	possibly damaging	Het
Gm10384	T	C	15: 36,871,653		noncoding transcript	Het
Gm5117	G	A	8: 31,739,256		noncoding transcript	Het
Gpr141	T	A	13: 19,751,781	I275F	probably benign	Het
Greb1l	A	T	18: 10,522,112	E736V	probably damaging	Het
Hc	T	C	2: 35,039,248	E279G	possibly damaging	Het
Hivep1	C	T	13: 42,155,850	T522M	probably benign	Het
Hspa12a	T	A	19: 58,799,749	E547V	possibly damaging	Het
Il10ra	A	G	9: 45,269,059	L5S	probably damaging	Het
Iqcf6	G	T	9: 106,627,344	W69L	probably damaging	Het
Iqgap2	T	C	13: 95,721,609	N379S	probably damaging	Het
Itpr2	A	G	6: 146,229,775	I1977T	probably damaging	Het
Kcnq1	A	T	7: 143,107,729	Y124F	probably benign	Het
Lamp5	C	T	2: 136,059,003	T41M	probably damaging	Het
Lgr5	A	G	10: 115,458,743		probably benign	Het
Mlec	A	G	5: 115,150,296	I167T	possibly damaging	Het
Myf6	A	G	10: 107,493,828	V198A	probably benign	Het
Nceh1	C	T	3: 27,241,669	R360C	probably damaging	Het
Nos2	C	A	11: 78,928,630	T56N	possibly damaging	Het
Npw	T	G	17: 24,657,412	H175P	probably benign	Het
Nrxn3	A	T	12: 89,510,651	I899F	probably damaging	Het
Ociad1	A	G	5: 73,306,735	T179A	possibly damaging	Het
Olfr378	A	G	11: 73,425,438	S182P	probably benign	Het
Olfr547	A	G	7: 102,535,149	Y134C	probably damaging	Het
Olfr912	T	A	9: 38,582,031	F251L	probably damaging	Het
Pacsin2	T	C	15: 83,381,775	N74D	probably benign	Het
Pcdh7	A	G	5: 58,129,169	I1196V	probably benign	Het
Pdxk	A	T	10: 78,447,003		probably null	Het
Phb2	G	A	6: 124,713,142		probably null	Het
Pus7l	T	A	15: 94,540,211	N251I	probably damaging	Het
Rgs7bp	T	A	13: 104,964,089	N226I	probably damaging	Het
Runx2	T	A	17: 44,639,685	D327V	probably damaging	Het
Srp68	A	T	11: 116,265,401	C172S	probably damaging	Het
Stk25	A	G	1: 93,623,420		probably null	Het
Tbrg4	C	T	11: 6,618,468	R437Q	probably benign	Het
Tedc2	C	T	17: 24,217,888		probably null	Het
Teddm1a	T	A	1: 153,892,450	I220N	probably damaging	Het
Thoc1	G	T	18: 9,970,312	E221*	probably null	Het
Tmem132d	G	T	5: 127,792,610	D553E	possibly damaging	Het
Topors	A	T	4: 40,261,694	V530D	probably benign	Het
Tpx2	T	C	2: 152,889,183	V515A	possibly damaging	Het
Trim24	A	G	6: 37,908,305	H191R	probably damaging	Het
Ttn	G	A	2: 76,737,570	R27660W	probably damaging	Het
Vmn1r203	T	C	13: 22,524,358	L103P	probably damaging	Het
Vmn1r233	C	T	17: 20,994,106	S194N	probably benign	Het
Vmn2r108	T	C	17: 20,471,374	K296E	probably damaging	Het
Vmn2r88	G	A	14: 51,413,339	E170K	probably benign	Het
Zfp740	C	T	15: 102,208,749		probably benign	Het
Zmym5	A	G	14: 56,812,161		probably benign	Het

Other mutations in Adamtsl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00423:Adamtsl2	APN	2	27085088	missense	probably damaging	1.00
IGL01902:Adamtsl2	APN	2	27087252	missense	probably damaging	1.00
IGL02207:Adamtsl2	APN	2	27102981	missense	probably damaging	0.99
IGL02247:Adamtsl2	APN	2	27084893	missense	probably damaging	1.00
IGL02253:Adamtsl2	APN	2	27098697	missense	possibly damaging	0.48
IGL02655:Adamtsl2	APN	2	27082530	splice site	probably benign
IGL03148:Adamtsl2	APN	2	27084059	missense	probably damaging	0.99
IGL03269:Adamtsl2	APN	2	27108355	nonsense	probably null
R0609:Adamtsl2	UTSW	2	27089635	missense	probably benign	0.25
R1183:Adamtsl2	UTSW	2	27084080	missense	probably damaging	1.00
R1443:Adamtsl2	UTSW	2	27103066	missense	possibly damaging	0.89
R1675:Adamtsl2	UTSW	2	27082485	frame shift	probably null
R1698:Adamtsl2	UTSW	2	27103127	missense	possibly damaging	0.92
R1765:Adamtsl2	UTSW	2	27102830	missense	probably benign	0.01
R1934:Adamtsl2	UTSW	2	27089593	missense	probably damaging	0.99
R2106:Adamtsl2	UTSW	2	27102825	missense	probably benign	0.02
R2108:Adamtsl2	UTSW	2	27095558	missense	probably benign
R2189:Adamtsl2	UTSW	2	27081738	missense	probably benign	0.00
R2232:Adamtsl2	UTSW	2	27103178	missense	probably damaging	1.00
R4301:Adamtsl2	UTSW	2	27087283	missense	probably null	1.00
R4518:Adamtsl2	UTSW	2	27095547	missense	probably benign	0.00
R4572:Adamtsl2	UTSW	2	27083256	missense	probably damaging	0.99
R4627:Adamtsl2	UTSW	2	27093585	missense	probably damaging	0.99
R4668:Adamtsl2	UTSW	2	27095475	missense	probably benign	0.00
R4821:Adamtsl2	UTSW	2	27098592	splice site	probably null
R5054:Adamtsl2	UTSW	2	27101720	missense	probably damaging	1.00
R5460:Adamtsl2	UTSW	2	27095398	splice site	probably null
R5569:Adamtsl2	UTSW	2	27102833	missense	probably damaging	1.00
R5694:Adamtsl2	UTSW	2	27081724	missense	probably benign	0.03
R6836:Adamtsl2	UTSW	2	27081706	start codon destroyed	probably null	0.90
R7103:Adamtsl2	UTSW	2	27107461	missense	probably damaging	1.00
R7437:Adamtsl2	UTSW	2	27089709	missense	probably damaging	0.99
R8089:Adamtsl2	UTSW	2	27104797	missense	probably benign	0.00
R8389:Adamtsl2	UTSW	2	27103124	missense	possibly damaging	0.71
R9284:Adamtsl2	UTSW	2	27104043	splice site	probably benign
R9566:Adamtsl2	UTSW	2	27089761	critical splice donor site	probably null
R9772:Adamtsl2	UTSW	2	27095654	missense	probably benign
X0003:Adamtsl2	UTSW	2	27081772	small deletion	probably benign
X0003:Adamtsl2	UTSW	2	27081773	small deletion	probably benign
Z1176:Adamtsl2	UTSW	2	27081720	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TACAGCTTCTCTGAGGCAGC -3'
(R):5'- CCCAGAGAGATGTGCAAGCAAC -3'

Sequencing Primer
(F):5'- GCCTCCCAGAGCACAGAGAG -3'
(R):5'- GATGTGCAAGCAACTGAAATTCTCC -3'

Posted On

2015-10-21