Incidental Mutation 'R4686:Clnk'
ID353662
Institutional Source Beutler Lab
Gene Symbol Clnk
Ensembl Gene ENSMUSG00000039315
Gene Namecytokine-dependent hematopoietic cell linker
SynonymsMIST
MMRRC Submission 041937-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R4686 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location38706462-38876812 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to A at 38741837 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132779 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169819] [ENSMUST00000171633]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114080
Predicted Effect probably benign
Transcript: ENSMUST00000169819
SMART Domains Protein: ENSMUSP00000128473
Gene: ENSMUSG00000039315

DomainStartEndE-ValueType
low complexity region 158 188 N/A INTRINSIC
SH2 307 398 3.53e-19 SMART
low complexity region 414 427 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171633
SMART Domains Protein: ENSMUSP00000132779
Gene: ENSMUSG00000039315

DomainStartEndE-ValueType
low complexity region 158 188 N/A INTRINSIC
SH2 307 398 3.53e-19 SMART
low complexity region 414 427 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177682
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MIST is a member of the SLP76 family of adaptors (see LCP2, MIM 601603; BLNK, MIM 604515). MIST plays a role in the regulation of immunoreceptor signaling, including PLC-gamma (PLCG1; MIM 172420)-mediated B cell antigen receptor (BCR) signaling and FC-epsilon R1 (see FCER1A, MIM 147140)-mediated mast cell degranulation (Cao et al., 1999 [PubMed 10562326]; Goitsuka et al., 2000, 2001 [PubMed 10744659] [PubMed 11463797]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a reporter allele display altered natural killer (NK) T cell physiology and enhanced NK cell cytolysis. Mice homozygous for knock-out allele display abnormal mast cell physiology as well as enhanced NK cell cytolysis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl2 A G 2: 27,093,825 N411S probably damaging Het
Adnp A C 2: 168,182,389 C995W possibly damaging Het
Akap6 CA C 12: 52,887,623 probably null Het
Ano2 T G 6: 125,790,291 I228M probably benign Het
Arhgap21 T C 2: 20,863,222 D830G probably damaging Het
Atp13a2 G A 4: 141,003,276 probably null Het
Ccdc175 C T 12: 72,112,278 S629N probably damaging Het
Cdhr4 T C 9: 107,995,684 W311R probably benign Het
Chaf1b A G 16: 93,884,584 H30R probably benign Het
Copb1 A G 7: 114,221,736 S773P possibly damaging Het
Cse1l A G 2: 166,932,160 D198G probably damaging Het
Ears2 A G 7: 122,048,204 S286P probably damaging Het
Efcab7 A G 4: 99,878,116 E114G probably benign Het
Fanca G C 8: 123,268,934 probably benign Het
Flt3 A G 5: 147,377,048 L64P probably damaging Het
Gabrb1 A G 5: 71,700,022 T3A possibly damaging Het
Gm10384 T C 15: 36,871,653 noncoding transcript Het
Gm5117 G A 8: 31,739,256 noncoding transcript Het
Gpr141 T A 13: 19,751,781 I275F probably benign Het
Greb1l A T 18: 10,522,112 E736V probably damaging Het
Hc T C 2: 35,039,248 E279G possibly damaging Het
Hivep1 C T 13: 42,155,850 T522M probably benign Het
Hspa12a T A 19: 58,799,749 E547V possibly damaging Het
Il10ra A G 9: 45,269,059 L5S probably damaging Het
Iqcf6 G T 9: 106,627,344 W69L probably damaging Het
Iqgap2 T C 13: 95,721,609 N379S probably damaging Het
Itpr2 A G 6: 146,229,775 I1977T probably damaging Het
Kcnq1 A T 7: 143,107,729 Y124F probably benign Het
Lamp5 C T 2: 136,059,003 T41M probably damaging Het
Lgr5 A G 10: 115,458,743 probably benign Het
Mlec A G 5: 115,150,296 I167T possibly damaging Het
Myf6 A G 10: 107,493,828 V198A probably benign Het
Nceh1 C T 3: 27,241,669 R360C probably damaging Het
Nos2 C A 11: 78,928,630 T56N possibly damaging Het
Npw T G 17: 24,657,412 H175P probably benign Het
Nrxn3 A T 12: 89,510,651 I899F probably damaging Het
Ociad1 A G 5: 73,306,735 T179A possibly damaging Het
Olfr378 A G 11: 73,425,438 S182P probably benign Het
Olfr547 A G 7: 102,535,149 Y134C probably damaging Het
Olfr912 T A 9: 38,582,031 F251L probably damaging Het
Pacsin2 T C 15: 83,381,775 N74D probably benign Het
Pcdh7 A G 5: 58,129,169 I1196V probably benign Het
Pdxk A T 10: 78,447,003 probably null Het
Phb2 G A 6: 124,713,142 probably null Het
Pus7l T A 15: 94,540,211 N251I probably damaging Het
Rgs7bp T A 13: 104,964,089 N226I probably damaging Het
Runx2 T A 17: 44,639,685 D327V probably damaging Het
Srp68 A T 11: 116,265,401 C172S probably damaging Het
Stk25 A G 1: 93,623,420 probably null Het
Tbrg4 C T 11: 6,618,468 R437Q probably benign Het
Tedc2 C T 17: 24,217,888 probably null Het
Teddm1a T A 1: 153,892,450 I220N probably damaging Het
Thoc1 G T 18: 9,970,312 E221* probably null Het
Tmem132d G T 5: 127,792,610 D553E possibly damaging Het
Topors A T 4: 40,261,694 V530D probably benign Het
Tpx2 T C 2: 152,889,183 V515A possibly damaging Het
Trim24 A G 6: 37,908,305 H191R probably damaging Het
Ttn G A 2: 76,737,570 R27660W probably damaging Het
Vmn1r203 T C 13: 22,524,358 L103P probably damaging Het
Vmn1r233 C T 17: 20,994,106 S194N probably benign Het
Vmn2r108 T C 17: 20,471,374 K296E probably damaging Het
Vmn2r88 G A 14: 51,413,339 E170K probably benign Het
Zfp740 C T 15: 102,208,749 probably benign Het
Zmym5 A G 14: 56,812,161 probably benign Het
Other mutations in Clnk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01328:Clnk APN 5 38784528 missense possibly damaging 0.95
IGL01348:Clnk APN 5 38713207 missense probably damaging 1.00
IGL01901:Clnk APN 5 38794978 missense probably damaging 1.00
IGL01908:Clnk APN 5 38713142 missense probably damaging 1.00
IGL02437:Clnk APN 5 38774566 critical splice donor site probably null
IGL02745:Clnk APN 5 38736319 missense probably benign 0.00
R0138:Clnk UTSW 5 38774608 splice site probably benign
R0196:Clnk UTSW 5 38769939 missense probably damaging 0.97
R1522:Clnk UTSW 5 38794966 missense probably damaging 1.00
R1958:Clnk UTSW 5 38706626 missense possibly damaging 0.96
R2036:Clnk UTSW 5 38752800 splice site probably null
R2238:Clnk UTSW 5 38764351 splice site probably benign
R3788:Clnk UTSW 5 38714998 missense probably damaging 1.00
R3931:Clnk UTSW 5 38768069 missense probably benign
R4159:Clnk UTSW 5 38741795 intron probably benign
R4182:Clnk UTSW 5 38747850 intron probably benign
R4751:Clnk UTSW 5 38720913 missense probably benign 0.06
R4842:Clnk UTSW 5 38713069 splice site probably null
R5811:Clnk UTSW 5 38713147 missense probably damaging 1.00
R6236:Clnk UTSW 5 38713199 missense probably benign 0.41
R7157:Clnk UTSW 5 38769891 missense possibly damaging 0.63
R7615:Clnk UTSW 5 38706698 missense probably damaging 1.00
R7618:Clnk UTSW 5 38736355 missense probably benign 0.06
R7762:Clnk UTSW 5 38768141 missense probably benign 0.24
R7768:Clnk UTSW 5 38768158 missense probably damaging 1.00
R7823:Clnk UTSW 5 38750351 missense probably benign 0.00
R8158:Clnk UTSW 5 38794911 critical splice donor site probably null
R8423:Clnk UTSW 5 38794910 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CACAGTGAAATCTCTCTAGTTCTACTG -3'
(R):5'- AGCCCCTACTTGGTTGCATG -3'

Sequencing Primer
(F):5'- TTGAGTGAGGTAGAAGTGC -3'
(R):5'- CCTACTTGGTTGCATGGGGTAAAAAG -3'
Posted On2015-10-21