Incidental Mutation 'R4686:Gabrb1'
ID 353664
Institutional Source Beutler Lab
Gene Symbol Gabrb1
Ensembl Gene ENSMUSG00000029212
Gene Name gamma-aminobutyric acid type A receptor subunit beta 1
Synonyms Gabrb-1, B230208N19Rik
MMRRC Submission 041937-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4686 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 71815456-72306380 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 71857365 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 3 (T3A)
Ref Sequence ENSEMBL: ENSMUSP00000031122 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031122] [ENSMUST00000199967]
AlphaFold P50571
Predicted Effect possibly damaging
Transcript: ENSMUST00000031122
AA Change: T3A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000031122
Gene: ENSMUSG00000029212
AA Change: T3A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Neur_chan_LBD 37 243 7.1e-52 PFAM
Pfam:Neur_chan_memb 250 469 2.4e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199398
Predicted Effect probably benign
Transcript: ENSMUST00000199967
SMART Domains Protein: ENSMUSP00000143682
Gene: ENSMUSG00000029212

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 4 210 4.8e-51 PFAM
Meta Mutation Damage Score 0.0607 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gamma-aminobutyric acid (GABA) A receptor is a multisubunit chloride channel that mediates the fastest inhibitory synaptic transmission in the central nervous system. This gene encodes GABA A receptor, beta 1 subunit. It is mapped to chromosome 4p12 in a cluster comprised of genes encoding alpha 4, alpha 2 and gamma 1 subunits of the GABA A receptor. Alteration of this gene is implicated in the pathogenetics of schizophrenia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for an ENU or spontaneous mutation exhibit alcohol preference with increased tonic inhibition, female infertility and hypothalamic pituitary axis dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl2 A G 2: 26,983,837 (GRCm39) N411S probably damaging Het
Adnp A C 2: 168,024,309 (GRCm39) C995W possibly damaging Het
Akap6 CA C 12: 52,934,406 (GRCm39) probably null Het
Ano2 T G 6: 125,767,254 (GRCm39) I228M probably benign Het
Arhgap21 T C 2: 20,868,033 (GRCm39) D830G probably damaging Het
Atp13a2 G A 4: 140,730,587 (GRCm39) probably null Het
Ccdc175 C T 12: 72,159,052 (GRCm39) S629N probably damaging Het
Cdhr4 T C 9: 107,872,883 (GRCm39) W311R probably benign Het
Chaf1b A G 16: 93,681,472 (GRCm39) H30R probably benign Het
Clnk G A 5: 38,899,180 (GRCm39) probably benign Het
Copb1 A G 7: 113,820,971 (GRCm39) S773P possibly damaging Het
Cse1l A G 2: 166,774,080 (GRCm39) D198G probably damaging Het
Ears2 A G 7: 121,647,427 (GRCm39) S286P probably damaging Het
Efcab7 A G 4: 99,735,318 (GRCm39) E114G probably benign Het
Fanca G C 8: 123,995,673 (GRCm39) probably benign Het
Flt3 A G 5: 147,313,858 (GRCm39) L64P probably damaging Het
Gm10384 T C 15: 36,871,897 (GRCm39) noncoding transcript Het
Gm5117 G A 8: 32,229,284 (GRCm39) noncoding transcript Het
Gpr141 T A 13: 19,935,951 (GRCm39) I275F probably benign Het
Greb1l A T 18: 10,522,112 (GRCm39) E736V probably damaging Het
Hc T C 2: 34,929,260 (GRCm39) E279G possibly damaging Het
Hivep1 C T 13: 42,309,326 (GRCm39) T522M probably benign Het
Hspa12a T A 19: 58,788,181 (GRCm39) E547V possibly damaging Het
Il10ra A G 9: 45,180,357 (GRCm39) L5S probably damaging Het
Iqcf6 G T 9: 106,504,543 (GRCm39) W69L probably damaging Het
Iqgap2 T C 13: 95,858,117 (GRCm39) N379S probably damaging Het
Itpr2 A G 6: 146,131,273 (GRCm39) I1977T probably damaging Het
Kcnq1 A T 7: 142,661,466 (GRCm39) Y124F probably benign Het
Lamp5 C T 2: 135,900,923 (GRCm39) T41M probably damaging Het
Lgr5 A G 10: 115,294,648 (GRCm39) probably benign Het
Mlec A G 5: 115,288,355 (GRCm39) I167T possibly damaging Het
Myf6 A G 10: 107,329,689 (GRCm39) V198A probably benign Het
Nceh1 C T 3: 27,295,818 (GRCm39) R360C probably damaging Het
Nos2 C A 11: 78,819,456 (GRCm39) T56N possibly damaging Het
Npw T G 17: 24,876,386 (GRCm39) H175P probably benign Het
Nrxn3 A T 12: 89,477,421 (GRCm39) I899F probably damaging Het
Ociad1 A G 5: 73,464,078 (GRCm39) T179A possibly damaging Het
Or1e19 A G 11: 73,316,264 (GRCm39) S182P probably benign Het
Or52b4 A G 7: 102,184,356 (GRCm39) Y134C probably damaging Het
Or8b48 T A 9: 38,493,327 (GRCm39) F251L probably damaging Het
Pacsin2 T C 15: 83,265,976 (GRCm39) N74D probably benign Het
Pcdh7 A G 5: 58,286,511 (GRCm39) I1196V probably benign Het
Pdxk A T 10: 78,282,837 (GRCm39) probably null Het
Phb2 G A 6: 124,690,105 (GRCm39) probably null Het
Pus7l T A 15: 94,438,092 (GRCm39) N251I probably damaging Het
Rgs7bp T A 13: 105,100,597 (GRCm39) N226I probably damaging Het
Runx2 T A 17: 44,950,572 (GRCm39) D327V probably damaging Het
Srp68 A T 11: 116,156,227 (GRCm39) C172S probably damaging Het
Stk25 A G 1: 93,551,142 (GRCm39) probably null Het
Tbrg4 C T 11: 6,568,468 (GRCm39) R437Q probably benign Het
Tedc2 C T 17: 24,436,862 (GRCm39) probably null Het
Teddm1a T A 1: 153,768,196 (GRCm39) I220N probably damaging Het
Thoc1 G T 18: 9,970,312 (GRCm39) E221* probably null Het
Tmem132d G T 5: 127,869,674 (GRCm39) D553E possibly damaging Het
Topors A T 4: 40,261,694 (GRCm39) V530D probably benign Het
Tpx2 T C 2: 152,731,103 (GRCm39) V515A possibly damaging Het
Trim24 A G 6: 37,885,240 (GRCm39) H191R probably damaging Het
Ttn G A 2: 76,567,914 (GRCm39) R27660W probably damaging Het
Vmn1r203 T C 13: 22,708,528 (GRCm39) L103P probably damaging Het
Vmn1r233 C T 17: 21,214,368 (GRCm39) S194N probably benign Het
Vmn2r108 T C 17: 20,691,636 (GRCm39) K296E probably damaging Het
Vmn2r88 G A 14: 51,650,796 (GRCm39) E170K probably benign Het
Zfp740 C T 15: 102,117,184 (GRCm39) probably benign Het
Zmym5 A G 14: 57,049,618 (GRCm39) probably benign Het
Other mutations in Gabrb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00770:Gabrb1 APN 5 72,265,789 (GRCm39) critical splice donor site probably null
IGL00774:Gabrb1 APN 5 72,265,789 (GRCm39) critical splice donor site probably null
IGL01534:Gabrb1 APN 5 72,026,772 (GRCm39) missense possibly damaging 0.95
IGL02170:Gabrb1 APN 5 72,294,073 (GRCm39) missense probably damaging 1.00
IGL02326:Gabrb1 APN 5 71,858,190 (GRCm39) missense probably damaging 0.99
IGL03278:Gabrb1 APN 5 72,026,939 (GRCm39) missense probably damaging 1.00
IGL03345:Gabrb1 APN 5 72,293,908 (GRCm39) missense possibly damaging 0.53
IGL03050:Gabrb1 UTSW 5 72,279,497 (GRCm39) missense probably benign 0.03
PIT4445001:Gabrb1 UTSW 5 72,266,125 (GRCm39) missense probably damaging 1.00
PIT4515001:Gabrb1 UTSW 5 71,858,160 (GRCm39) missense probably damaging 1.00
R0109:Gabrb1 UTSW 5 72,279,289 (GRCm39) splice site probably benign
R0386:Gabrb1 UTSW 5 72,266,150 (GRCm39) missense probably damaging 0.99
R1512:Gabrb1 UTSW 5 72,266,048 (GRCm39) missense probably damaging 1.00
R1512:Gabrb1 UTSW 5 72,266,047 (GRCm39) missense probably damaging 1.00
R1717:Gabrb1 UTSW 5 72,265,694 (GRCm39) splice site probably null
R1832:Gabrb1 UTSW 5 72,279,281 (GRCm39) splice site probably null
R1961:Gabrb1 UTSW 5 71,857,679 (GRCm39) missense probably benign 0.28
R2363:Gabrb1 UTSW 5 72,026,916 (GRCm39) nonsense probably null
R4840:Gabrb1 UTSW 5 71,858,154 (GRCm39) missense probably damaging 1.00
R4916:Gabrb1 UTSW 5 72,026,764 (GRCm39) missense probably damaging 1.00
R4941:Gabrb1 UTSW 5 72,294,121 (GRCm39) missense probably damaging 1.00
R5250:Gabrb1 UTSW 5 72,026,922 (GRCm39) missense possibly damaging 0.80
R5270:Gabrb1 UTSW 5 72,265,669 (GRCm39) missense probably damaging 1.00
R5364:Gabrb1 UTSW 5 72,294,105 (GRCm39) missense probably benign 0.33
R5407:Gabrb1 UTSW 5 72,279,364 (GRCm39) missense possibly damaging 0.90
R5621:Gabrb1 UTSW 5 72,266,071 (GRCm39) missense probably damaging 1.00
R5790:Gabrb1 UTSW 5 72,293,827 (GRCm39) missense possibly damaging 0.53
R6236:Gabrb1 UTSW 5 72,265,663 (GRCm39) missense probably damaging 1.00
R6336:Gabrb1 UTSW 5 72,187,241 (GRCm39) missense possibly damaging 0.72
R7411:Gabrb1 UTSW 5 72,279,538 (GRCm39) critical splice donor site probably null
R8375:Gabrb1 UTSW 5 72,187,172 (GRCm39) missense probably damaging 0.98
R9161:Gabrb1 UTSW 5 72,187,199 (GRCm39) missense probably damaging 0.98
R9474:Gabrb1 UTSW 5 72,265,690 (GRCm39) missense probably damaging 1.00
R9621:Gabrb1 UTSW 5 72,279,363 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GTATTCGACTACCCAGAGAACG -3'
(R):5'- TACATGATCCAGCAGGCACG -3'

Sequencing Primer
(F):5'- AAAGGGATTGAAATCTGTTGCCTG -3'
(R):5'- CCTGTGTGCACAACAAA -3'
Posted On 2015-10-21