Incidental Mutation 'R4686:Ociad1'
ID353665
Institutional Source Beutler Lab
Gene Symbol Ociad1
Ensembl Gene ENSMUSG00000029152
Gene NameOCIA domain containing 1
SynonymsB230209J16Rik, Emi2, TPA018, 6030432N09Rik, Imi2, expressed during mesenchymal induction 2, Asrij
MMRRC Submission 041937-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R4686 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location73292784-73314069 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73306735 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 179 (T179A)
Ref Sequence ENSEMBL: ENSMUSP00000143799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031038] [ENSMUST00000071081] [ENSMUST00000166823] [ENSMUST00000200935] [ENSMUST00000201556] [ENSMUST00000201739] [ENSMUST00000202237] [ENSMUST00000202250]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031038
AA Change: T179A

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000031038
Gene: ENSMUSG00000029152
AA Change: T179A

DomainStartEndE-ValueType
Pfam:OCIA 8 112 8e-41 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000071081
AA Change: T179A

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000069412
Gene: ENSMUSG00000029152
AA Change: T179A

DomainStartEndE-ValueType
Pfam:OCIA 3 112 8.3e-44 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000166823
AA Change: T179A

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000128805
Gene: ENSMUSG00000029152
AA Change: T179A

DomainStartEndE-ValueType
Pfam:OCIA 3 112 8.3e-44 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000200935
AA Change: T179A

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000144515
Gene: ENSMUSG00000029152
AA Change: T179A

DomainStartEndE-ValueType
Pfam:OCIA 8 112 4.6e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201191
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201272
Predicted Effect probably benign
Transcript: ENSMUST00000201556
SMART Domains Protein: ENSMUSP00000144227
Gene: ENSMUSG00000029152

DomainStartEndE-ValueType
Pfam:OCIA 8 112 1.7e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201739
Predicted Effect possibly damaging
Transcript: ENSMUST00000202237
AA Change: T125A

PolyPhen 2 Score 0.549 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000144102
Gene: ENSMUSG00000029152
AA Change: T125A

DomainStartEndE-ValueType
Pfam:OCIA 1 58 1.8e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000202250
AA Change: T179A

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000143799
Gene: ENSMUSG00000029152
AA Change: T179A

DomainStartEndE-ValueType
Pfam:OCIA 8 112 4.2e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202887
Meta Mutation Damage Score 0.0607 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 97% (68/70)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl2 A G 2: 27,093,825 N411S probably damaging Het
Adnp A C 2: 168,182,389 C995W possibly damaging Het
Akap6 CA C 12: 52,887,623 probably null Het
Ano2 T G 6: 125,790,291 I228M probably benign Het
Arhgap21 T C 2: 20,863,222 D830G probably damaging Het
Atp13a2 G A 4: 141,003,276 probably null Het
Ccdc175 C T 12: 72,112,278 S629N probably damaging Het
Cdhr4 T C 9: 107,995,684 W311R probably benign Het
Chaf1b A G 16: 93,884,584 H30R probably benign Het
Clnk G A 5: 38,741,837 probably benign Het
Copb1 A G 7: 114,221,736 S773P possibly damaging Het
Cse1l A G 2: 166,932,160 D198G probably damaging Het
Ears2 A G 7: 122,048,204 S286P probably damaging Het
Efcab7 A G 4: 99,878,116 E114G probably benign Het
Fanca G C 8: 123,268,934 probably benign Het
Flt3 A G 5: 147,377,048 L64P probably damaging Het
Gabrb1 A G 5: 71,700,022 T3A possibly damaging Het
Gm10384 T C 15: 36,871,653 noncoding transcript Het
Gm5117 G A 8: 31,739,256 noncoding transcript Het
Gpr141 T A 13: 19,751,781 I275F probably benign Het
Greb1l A T 18: 10,522,112 E736V probably damaging Het
Hc T C 2: 35,039,248 E279G possibly damaging Het
Hivep1 C T 13: 42,155,850 T522M probably benign Het
Hspa12a T A 19: 58,799,749 E547V possibly damaging Het
Il10ra A G 9: 45,269,059 L5S probably damaging Het
Iqcf6 G T 9: 106,627,344 W69L probably damaging Het
Iqgap2 T C 13: 95,721,609 N379S probably damaging Het
Itpr2 A G 6: 146,229,775 I1977T probably damaging Het
Kcnq1 A T 7: 143,107,729 Y124F probably benign Het
Lamp5 C T 2: 136,059,003 T41M probably damaging Het
Lgr5 A G 10: 115,458,743 probably benign Het
Mlec A G 5: 115,150,296 I167T possibly damaging Het
Myf6 A G 10: 107,493,828 V198A probably benign Het
Nceh1 C T 3: 27,241,669 R360C probably damaging Het
Nos2 C A 11: 78,928,630 T56N possibly damaging Het
Npw T G 17: 24,657,412 H175P probably benign Het
Nrxn3 A T 12: 89,510,651 I899F probably damaging Het
Olfr378 A G 11: 73,425,438 S182P probably benign Het
Olfr547 A G 7: 102,535,149 Y134C probably damaging Het
Olfr912 T A 9: 38,582,031 F251L probably damaging Het
Pacsin2 T C 15: 83,381,775 N74D probably benign Het
Pcdh7 A G 5: 58,129,169 I1196V probably benign Het
Pdxk A T 10: 78,447,003 probably null Het
Phb2 G A 6: 124,713,142 probably null Het
Pus7l T A 15: 94,540,211 N251I probably damaging Het
Rgs7bp T A 13: 104,964,089 N226I probably damaging Het
Runx2 T A 17: 44,639,685 D327V probably damaging Het
Srp68 A T 11: 116,265,401 C172S probably damaging Het
Stk25 A G 1: 93,623,420 probably null Het
Tbrg4 C T 11: 6,618,468 R437Q probably benign Het
Tedc2 C T 17: 24,217,888 probably null Het
Teddm1a T A 1: 153,892,450 I220N probably damaging Het
Thoc1 G T 18: 9,970,312 E221* probably null Het
Tmem132d G T 5: 127,792,610 D553E possibly damaging Het
Topors A T 4: 40,261,694 V530D probably benign Het
Tpx2 T C 2: 152,889,183 V515A possibly damaging Het
Trim24 A G 6: 37,908,305 H191R probably damaging Het
Ttn G A 2: 76,737,570 R27660W probably damaging Het
Vmn1r203 T C 13: 22,524,358 L103P probably damaging Het
Vmn1r233 C T 17: 20,994,106 S194N probably benign Het
Vmn2r108 T C 17: 20,471,374 K296E probably damaging Het
Vmn2r88 G A 14: 51,413,339 E170K probably benign Het
Zfp740 C T 15: 102,208,749 probably benign Het
Zmym5 A G 14: 56,812,161 probably benign Het
Other mutations in Ociad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Ociad1 APN 5 73304543 splice site probably benign
IGL00801:Ociad1 APN 5 73304566 missense probably damaging 1.00
IGL02402:Ociad1 APN 5 73300694 missense possibly damaging 0.72
IGL03197:Ociad1 APN 5 73294332 missense probably benign 0.00
Bequerel UTSW 5 73310382 missense probably benign 0.01
Curie UTSW 5 73310345 nonsense probably null
R0420:Ociad1 UTSW 5 73313429 splice site probably null
R0707:Ociad1 UTSW 5 73294912 splice site probably benign
R1130:Ociad1 UTSW 5 73294332 missense probably benign 0.00
R1744:Ociad1 UTSW 5 73300719 critical splice donor site probably null
R2848:Ociad1 UTSW 5 73294351 splice site probably null
R3157:Ociad1 UTSW 5 73310345 nonsense probably null
R3159:Ociad1 UTSW 5 73310345 nonsense probably null
R5002:Ociad1 UTSW 5 73310316 missense possibly damaging 0.82
R5398:Ociad1 UTSW 5 73310412 missense probably benign 0.00
R5483:Ociad1 UTSW 5 73294971 missense probably damaging 1.00
R5921:Ociad1 UTSW 5 73310382 missense probably benign 0.01
R7220:Ociad1 UTSW 5 73313466 missense probably benign 0.00
R7511:Ociad1 UTSW 5 73294995 missense probably damaging 1.00
R7796:Ociad1 UTSW 5 73294947 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGGCAATGATCCTTTGTTCTTAC -3'
(R):5'- TCACACCTAGCCAAGTATGTTG -3'

Sequencing Primer
(F):5'- TCTTTCGGGACATCTCCA -3'
(R):5'- TATGTTGGATGAATGAAGAGACCAAC -3'
Posted On2015-10-21