Incidental Mutation 'R4686:Olfr547'
ID353673
Institutional Source Beutler Lab
Gene Symbol Olfr547
Ensembl Gene ENSMUSG00000073979
Gene Nameolfactory receptor 547
SynonymsGA_x6K02T2PBJ9-5256044-5256988, MOR31-4
MMRRC Submission 041937-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R4686 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location102534749-102535684 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102535149 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 134 (Y134C)
Ref Sequence ENSEMBL: ENSMUSP00000095831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098229]
Predicted Effect probably damaging
Transcript: ENSMUST00000098229
AA Change: Y134C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095831
Gene: ENSMUSG00000073979
AA Change: Y134C

DomainStartEndE-ValueType
Pfam:7tm_4 33 311 1.1e-105 PFAM
Pfam:7TM_GPCR_Srsx 37 277 6.7e-10 PFAM
Pfam:7tm_1 43 294 1.2e-20 PFAM
Meta Mutation Damage Score 0.2395 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl2 A G 2: 27,093,825 N411S probably damaging Het
Adnp A C 2: 168,182,389 C995W possibly damaging Het
Akap6 CA C 12: 52,887,623 probably null Het
Ano2 T G 6: 125,790,291 I228M probably benign Het
Arhgap21 T C 2: 20,863,222 D830G probably damaging Het
Atp13a2 G A 4: 141,003,276 probably null Het
Ccdc175 C T 12: 72,112,278 S629N probably damaging Het
Cdhr4 T C 9: 107,995,684 W311R probably benign Het
Chaf1b A G 16: 93,884,584 H30R probably benign Het
Clnk G A 5: 38,741,837 probably benign Het
Copb1 A G 7: 114,221,736 S773P possibly damaging Het
Cse1l A G 2: 166,932,160 D198G probably damaging Het
Ears2 A G 7: 122,048,204 S286P probably damaging Het
Efcab7 A G 4: 99,878,116 E114G probably benign Het
Fanca G C 8: 123,268,934 probably benign Het
Flt3 A G 5: 147,377,048 L64P probably damaging Het
Gabrb1 A G 5: 71,700,022 T3A possibly damaging Het
Gm10384 T C 15: 36,871,653 noncoding transcript Het
Gm5117 G A 8: 31,739,256 noncoding transcript Het
Gpr141 T A 13: 19,751,781 I275F probably benign Het
Greb1l A T 18: 10,522,112 E736V probably damaging Het
Hc T C 2: 35,039,248 E279G possibly damaging Het
Hivep1 C T 13: 42,155,850 T522M probably benign Het
Hspa12a T A 19: 58,799,749 E547V possibly damaging Het
Il10ra A G 9: 45,269,059 L5S probably damaging Het
Iqcf6 G T 9: 106,627,344 W69L probably damaging Het
Iqgap2 T C 13: 95,721,609 N379S probably damaging Het
Itpr2 A G 6: 146,229,775 I1977T probably damaging Het
Kcnq1 A T 7: 143,107,729 Y124F probably benign Het
Lamp5 C T 2: 136,059,003 T41M probably damaging Het
Lgr5 A G 10: 115,458,743 probably benign Het
Mlec A G 5: 115,150,296 I167T possibly damaging Het
Myf6 A G 10: 107,493,828 V198A probably benign Het
Nceh1 C T 3: 27,241,669 R360C probably damaging Het
Nos2 C A 11: 78,928,630 T56N possibly damaging Het
Npw T G 17: 24,657,412 H175P probably benign Het
Nrxn3 A T 12: 89,510,651 I899F probably damaging Het
Ociad1 A G 5: 73,306,735 T179A possibly damaging Het
Olfr378 A G 11: 73,425,438 S182P probably benign Het
Olfr912 T A 9: 38,582,031 F251L probably damaging Het
Pacsin2 T C 15: 83,381,775 N74D probably benign Het
Pcdh7 A G 5: 58,129,169 I1196V probably benign Het
Pdxk A T 10: 78,447,003 probably null Het
Phb2 G A 6: 124,713,142 probably null Het
Pus7l T A 15: 94,540,211 N251I probably damaging Het
Rgs7bp T A 13: 104,964,089 N226I probably damaging Het
Runx2 T A 17: 44,639,685 D327V probably damaging Het
Srp68 A T 11: 116,265,401 C172S probably damaging Het
Stk25 A G 1: 93,623,420 probably null Het
Tbrg4 C T 11: 6,618,468 R437Q probably benign Het
Tedc2 C T 17: 24,217,888 probably null Het
Teddm1a T A 1: 153,892,450 I220N probably damaging Het
Thoc1 G T 18: 9,970,312 E221* probably null Het
Tmem132d G T 5: 127,792,610 D553E possibly damaging Het
Topors A T 4: 40,261,694 V530D probably benign Het
Tpx2 T C 2: 152,889,183 V515A possibly damaging Het
Trim24 A G 6: 37,908,305 H191R probably damaging Het
Ttn G A 2: 76,737,570 R27660W probably damaging Het
Vmn1r203 T C 13: 22,524,358 L103P probably damaging Het
Vmn1r233 C T 17: 20,994,106 S194N probably benign Het
Vmn2r108 T C 17: 20,471,374 K296E probably damaging Het
Vmn2r88 G A 14: 51,413,339 E170K probably benign Het
Zfp740 C T 15: 102,208,749 probably benign Het
Zmym5 A G 14: 56,812,161 probably benign Het
Other mutations in Olfr547
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01383:Olfr547 APN 7 102534933 missense probably benign 0.31
IGL01522:Olfr547 APN 7 102535184 missense probably damaging 0.97
IGL02182:Olfr547 APN 7 102535568 missense probably benign 0.00
IGL02669:Olfr547 APN 7 102535661 missense probably benign
IGL03139:Olfr547 APN 7 102535310 missense possibly damaging 0.95
FR4976:Olfr547 UTSW 7 102535681 makesense probably null
R1246:Olfr547 UTSW 7 102534942 missense probably damaging 1.00
R2884:Olfr547 UTSW 7 102535232 missense probably benign 0.03
R3852:Olfr547 UTSW 7 102535280 missense probably benign 0.01
R4879:Olfr547 UTSW 7 102534755 missense probably benign 0.00
R6169:Olfr547 UTSW 7 102535272 missense probably benign 0.02
R6213:Olfr547 UTSW 7 102534932 missense probably damaging 1.00
R7080:Olfr547 UTSW 7 102534965 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- ATCTTCATCATCCTCACAAGGC -3'
(R):5'- GCAAGCATATTTAGCCAAGCC -3'

Sequencing Primer
(F):5'- GGCAGACATTGTGCTCTCCAC -3'
(R):5'- GCCAAGCCTATGTGTTCACAATAGG -3'
Posted On2015-10-21