Incidental Mutation 'R4686:Gm5117'
ID353677
Institutional Source Beutler Lab
Gene Symbol Gm5117
Ensembl Gene ENSMUSG00000093862
Gene Namepredicted gene 5117
Synonyms
MMRRC Submission 041937-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.741) question?
Stock #R4686 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location31737208-31739760 bp(-) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) G to A at 31739256 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178878
SMART Domains Protein: ENSMUSP00000137046
Gene: ENSMUSG00000093862

DomainStartEndE-ValueType
low complexity region 147 158 N/A INTRINSIC
low complexity region 608 627 N/A INTRINSIC
Pfam:Met_10 666 799 1.5e-9 PFAM
Pfam:UPF0020 672 770 4e-8 PFAM
Pfam:Methyltransf_18 687 815 5e-10 PFAM
Pfam:Methyltransf_31 688 801 1.5e-10 PFAM
Pfam:Methyltransf_26 688 803 1e-8 PFAM
Pfam:Methyltransf_15 688 842 5e-48 PFAM
Meta Mutation Damage Score 0.0894 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 97% (68/70)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl2 A G 2: 27,093,825 N411S probably damaging Het
Adnp A C 2: 168,182,389 C995W possibly damaging Het
Akap6 CA C 12: 52,887,623 probably null Het
Ano2 T G 6: 125,790,291 I228M probably benign Het
Arhgap21 T C 2: 20,863,222 D830G probably damaging Het
Atp13a2 G A 4: 141,003,276 probably null Het
Ccdc175 C T 12: 72,112,278 S629N probably damaging Het
Cdhr4 T C 9: 107,995,684 W311R probably benign Het
Chaf1b A G 16: 93,884,584 H30R probably benign Het
Clnk G A 5: 38,741,837 probably benign Het
Copb1 A G 7: 114,221,736 S773P possibly damaging Het
Cse1l A G 2: 166,932,160 D198G probably damaging Het
Ears2 A G 7: 122,048,204 S286P probably damaging Het
Efcab7 A G 4: 99,878,116 E114G probably benign Het
Fanca G C 8: 123,268,934 probably benign Het
Flt3 A G 5: 147,377,048 L64P probably damaging Het
Gabrb1 A G 5: 71,700,022 T3A possibly damaging Het
Gm10384 T C 15: 36,871,653 noncoding transcript Het
Gpr141 T A 13: 19,751,781 I275F probably benign Het
Greb1l A T 18: 10,522,112 E736V probably damaging Het
Hc T C 2: 35,039,248 E279G possibly damaging Het
Hivep1 C T 13: 42,155,850 T522M probably benign Het
Hspa12a T A 19: 58,799,749 E547V possibly damaging Het
Il10ra A G 9: 45,269,059 L5S probably damaging Het
Iqcf6 G T 9: 106,627,344 W69L probably damaging Het
Iqgap2 T C 13: 95,721,609 N379S probably damaging Het
Itpr2 A G 6: 146,229,775 I1977T probably damaging Het
Kcnq1 A T 7: 143,107,729 Y124F probably benign Het
Lamp5 C T 2: 136,059,003 T41M probably damaging Het
Lgr5 A G 10: 115,458,743 probably benign Het
Mlec A G 5: 115,150,296 I167T possibly damaging Het
Myf6 A G 10: 107,493,828 V198A probably benign Het
Nceh1 C T 3: 27,241,669 R360C probably damaging Het
Nos2 C A 11: 78,928,630 T56N possibly damaging Het
Npw T G 17: 24,657,412 H175P probably benign Het
Nrxn3 A T 12: 89,510,651 I899F probably damaging Het
Ociad1 A G 5: 73,306,735 T179A possibly damaging Het
Olfr378 A G 11: 73,425,438 S182P probably benign Het
Olfr547 A G 7: 102,535,149 Y134C probably damaging Het
Olfr912 T A 9: 38,582,031 F251L probably damaging Het
Pacsin2 T C 15: 83,381,775 N74D probably benign Het
Pcdh7 A G 5: 58,129,169 I1196V probably benign Het
Pdxk A T 10: 78,447,003 probably null Het
Phb2 G A 6: 124,713,142 probably null Het
Pus7l T A 15: 94,540,211 N251I probably damaging Het
Rgs7bp T A 13: 104,964,089 N226I probably damaging Het
Runx2 T A 17: 44,639,685 D327V probably damaging Het
Srp68 A T 11: 116,265,401 C172S probably damaging Het
Stk25 A G 1: 93,623,420 probably null Het
Tbrg4 C T 11: 6,618,468 R437Q probably benign Het
Tedc2 C T 17: 24,217,888 probably null Het
Teddm1a T A 1: 153,892,450 I220N probably damaging Het
Thoc1 G T 18: 9,970,312 E221* probably null Het
Tmem132d G T 5: 127,792,610 D553E possibly damaging Het
Topors A T 4: 40,261,694 V530D probably benign Het
Tpx2 T C 2: 152,889,183 V515A possibly damaging Het
Trim24 A G 6: 37,908,305 H191R probably damaging Het
Ttn G A 2: 76,737,570 R27660W probably damaging Het
Vmn1r203 T C 13: 22,524,358 L103P probably damaging Het
Vmn1r233 C T 17: 20,994,106 S194N probably benign Het
Vmn2r108 T C 17: 20,471,374 K296E probably damaging Het
Vmn2r88 G A 14: 51,413,339 E170K probably benign Het
Zfp740 C T 15: 102,208,749 probably benign Het
Zmym5 A G 14: 56,812,161 probably benign Het
Other mutations in Gm5117
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01022:Gm5117 APN 8 31738487 exon noncoding transcript
IGL01362:Gm5117 APN 8 31737919 exon noncoding transcript
IGL01972:Gm5117 APN 8 31737759 exon noncoding transcript
IGL02100:Gm5117 APN 8 31737384 exon noncoding transcript
IGL02339:Gm5117 APN 8 31738226 exon noncoding transcript
IGL02366:Gm5117 APN 8 31737859 exon noncoding transcript
IGL02505:Gm5117 APN 8 31738316 exon noncoding transcript
IGL02698:Gm5117 APN 8 31739739 exon noncoding transcript
IGL03310:Gm5117 APN 8 31738808 exon noncoding transcript
IGL02835:Gm5117 UTSW 8 31737170 unclassified noncoding transcript
R1816:Gm5117 UTSW 8 31738958 exon noncoding transcript
R2157:Gm5117 UTSW 8 31738194 exon noncoding transcript
R2353:Gm5117 UTSW 8 31739195 exon noncoding transcript
R2404:Gm5117 UTSW 8 31737278 exon noncoding transcript
R2408:Gm5117 UTSW 8 31737278 exon noncoding transcript
R2409:Gm5117 UTSW 8 31737278 exon noncoding transcript
R2510:Gm5117 UTSW 8 31738355 exon noncoding transcript
R4953:Gm5117 UTSW 8 31738580 exon noncoding transcript
R5244:Gm5117 UTSW 8 31738277 exon noncoding transcript
R5275:Gm5117 UTSW 8 31739567 exon noncoding transcript
R5329:Gm5117 UTSW 8 31737882 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- AGGTTCAGAAGACAGTGTCTG -3'
(R):5'- TCGATTCTGAGGCCAAACTC -3'

Sequencing Primer
(F):5'- AAGACAGTGTCTGGTCTGGATAC -3'
(R):5'- TCGATTCTGAGGCCAAACTCATGAG -3'
Posted On2015-10-21