Incidental Mutation 'R4686:Nos2'
ID 353688
Institutional Source Beutler Lab
Gene Symbol Nos2
Ensembl Gene ENSMUSG00000020826
Gene Name nitric oxide synthase 2, inducible
Synonyms Nos2a, NOS-II, Nos-2, iNOS
MMRRC Submission 041937-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4686 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 78811613-78851052 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 78819456 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Asparagine at position 56 (T56N)
Ref Sequence ENSEMBL: ENSMUSP00000018610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018610] [ENSMUST00000214397]
AlphaFold P29477
PDB Structure MURINE INDUCIBLE NITRIC OXIDE SYNTHASE OXYGENASE DOMAIN (DELTA 114) (N-[(1,3-BENZODIOXOL-5-YL)METHYL]-1-[2-(1H-IMIDAZOL-1-YL)PYRIMIDIN-4-YL]-4-(METHOXYCARBONYL)-PIPERAZINE-2-ACETAMIDE COMPLEX [X-RAY DIFFRACTION]
MURINE INOSOXY DIMER WITH ISOTHIOUREA BOUND IN THE ACTIVE SITE [X-RAY DIFFRACTION]
MURINE INDUCIBLE NITRIC OXIDE SYNTHASE OXYGENASE DIMER N-HYDROXYARGININE AND 4-AMINO TETRAHYDROBIOPTERIN [X-RAY DIFFRACTION]
MURINE INDUCIBLE NITRIC OXIDE SYNTHASE OXYGENASE DIMER N-HYDROXYARGININE AND DIHYDROBIOPTERIN [X-RAY DIFFRACTION]
MURINE INDUCIBLE NITRIC OXIDE SYNTHASE OXYGENASE DIMER N-HYDROXYARGININE AND TETRAHYDROBIOPTERIN [X-RAY DIFFRACTION]
Murine Inducible Nitric Oxide Synthase Oxygenase Dimer (Delta 65) with W457F Mutation at Tetrahydrobiopterin Binding Site [X-RAY DIFFRACTION]
Murine Inducible Nitric Oxide Synthase Oxygenase Dimer (Delta 65) with W457A Mutation at Tetrahydrobiopterin Binding Site [X-RAY DIFFRACTION]
inducible nitric oxide synthase with Chlorzoxazone bound [X-RAY DIFFRACTION]
inducible nitric oxide synthase with 7-nitroindazole bound [X-RAY DIFFRACTION]
inducible nitric oxide synthase with 6-nitroindazole bound [X-RAY DIFFRACTION]
>> 40 additional structures at PDB <<
Predicted Effect possibly damaging
Transcript: ENSMUST00000018610
AA Change: T56N

PolyPhen 2 Score 0.653 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000018610
Gene: ENSMUSG00000020826
AA Change: T56N

DomainStartEndE-ValueType
Pfam:NO_synthase 129 491 6.7e-189 PFAM
Pfam:Flavodoxin_1 535 666 5.5e-43 PFAM
Pfam:FAD_binding_1 719 941 8.8e-79 PFAM
Pfam:NAD_binding_1 973 1087 4.1e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208783
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209121
Predicted Effect probably benign
Transcript: ENSMUST00000214397
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: Nitric oxide is a reactive free radical which acts as a biologic mediator in several processes, including neurotransmission and antimicrobial and antitumoral activities. This gene encodes a nitric oxide synthase that is inducible by a combination of lipopolysaccharide and certain cytokines. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous deletion of this gene alters susceptibility to infection, response to injury, sepsis and sensory stimuli, cardiac function, osteoclast, platelet and mammary gland physiology, tumor growth, testis and uterus morphology, diet-induced atherosclerosis, and blood, urine and glucose metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl2 A G 2: 26,983,837 (GRCm39) N411S probably damaging Het
Adnp A C 2: 168,024,309 (GRCm39) C995W possibly damaging Het
Akap6 CA C 12: 52,934,406 (GRCm39) probably null Het
Ano2 T G 6: 125,767,254 (GRCm39) I228M probably benign Het
Arhgap21 T C 2: 20,868,033 (GRCm39) D830G probably damaging Het
Atp13a2 G A 4: 140,730,587 (GRCm39) probably null Het
Ccdc175 C T 12: 72,159,052 (GRCm39) S629N probably damaging Het
Cdhr4 T C 9: 107,872,883 (GRCm39) W311R probably benign Het
Chaf1b A G 16: 93,681,472 (GRCm39) H30R probably benign Het
Clnk G A 5: 38,899,180 (GRCm39) probably benign Het
Copb1 A G 7: 113,820,971 (GRCm39) S773P possibly damaging Het
Cse1l A G 2: 166,774,080 (GRCm39) D198G probably damaging Het
Ears2 A G 7: 121,647,427 (GRCm39) S286P probably damaging Het
Efcab7 A G 4: 99,735,318 (GRCm39) E114G probably benign Het
Fanca G C 8: 123,995,673 (GRCm39) probably benign Het
Flt3 A G 5: 147,313,858 (GRCm39) L64P probably damaging Het
Gabrb1 A G 5: 71,857,365 (GRCm39) T3A possibly damaging Het
Gm10384 T C 15: 36,871,897 (GRCm39) noncoding transcript Het
Gm5117 G A 8: 32,229,284 (GRCm39) noncoding transcript Het
Gpr141 T A 13: 19,935,951 (GRCm39) I275F probably benign Het
Greb1l A T 18: 10,522,112 (GRCm39) E736V probably damaging Het
Hc T C 2: 34,929,260 (GRCm39) E279G possibly damaging Het
Hivep1 C T 13: 42,309,326 (GRCm39) T522M probably benign Het
Hspa12a T A 19: 58,788,181 (GRCm39) E547V possibly damaging Het
Il10ra A G 9: 45,180,357 (GRCm39) L5S probably damaging Het
Iqcf6 G T 9: 106,504,543 (GRCm39) W69L probably damaging Het
Iqgap2 T C 13: 95,858,117 (GRCm39) N379S probably damaging Het
Itpr2 A G 6: 146,131,273 (GRCm39) I1977T probably damaging Het
Kcnq1 A T 7: 142,661,466 (GRCm39) Y124F probably benign Het
Lamp5 C T 2: 135,900,923 (GRCm39) T41M probably damaging Het
Lgr5 A G 10: 115,294,648 (GRCm39) probably benign Het
Mlec A G 5: 115,288,355 (GRCm39) I167T possibly damaging Het
Myf6 A G 10: 107,329,689 (GRCm39) V198A probably benign Het
Nceh1 C T 3: 27,295,818 (GRCm39) R360C probably damaging Het
Npw T G 17: 24,876,386 (GRCm39) H175P probably benign Het
Nrxn3 A T 12: 89,477,421 (GRCm39) I899F probably damaging Het
Ociad1 A G 5: 73,464,078 (GRCm39) T179A possibly damaging Het
Or1e19 A G 11: 73,316,264 (GRCm39) S182P probably benign Het
Or52b4 A G 7: 102,184,356 (GRCm39) Y134C probably damaging Het
Or8b48 T A 9: 38,493,327 (GRCm39) F251L probably damaging Het
Pacsin2 T C 15: 83,265,976 (GRCm39) N74D probably benign Het
Pcdh7 A G 5: 58,286,511 (GRCm39) I1196V probably benign Het
Pdxk A T 10: 78,282,837 (GRCm39) probably null Het
Phb2 G A 6: 124,690,105 (GRCm39) probably null Het
Pus7l T A 15: 94,438,092 (GRCm39) N251I probably damaging Het
Rgs7bp T A 13: 105,100,597 (GRCm39) N226I probably damaging Het
Runx2 T A 17: 44,950,572 (GRCm39) D327V probably damaging Het
Srp68 A T 11: 116,156,227 (GRCm39) C172S probably damaging Het
Stk25 A G 1: 93,551,142 (GRCm39) probably null Het
Tbrg4 C T 11: 6,568,468 (GRCm39) R437Q probably benign Het
Tedc2 C T 17: 24,436,862 (GRCm39) probably null Het
Teddm1a T A 1: 153,768,196 (GRCm39) I220N probably damaging Het
Thoc1 G T 18: 9,970,312 (GRCm39) E221* probably null Het
Tmem132d G T 5: 127,869,674 (GRCm39) D553E possibly damaging Het
Topors A T 4: 40,261,694 (GRCm39) V530D probably benign Het
Tpx2 T C 2: 152,731,103 (GRCm39) V515A possibly damaging Het
Trim24 A G 6: 37,885,240 (GRCm39) H191R probably damaging Het
Ttn G A 2: 76,567,914 (GRCm39) R27660W probably damaging Het
Vmn1r203 T C 13: 22,708,528 (GRCm39) L103P probably damaging Het
Vmn1r233 C T 17: 21,214,368 (GRCm39) S194N probably benign Het
Vmn2r108 T C 17: 20,691,636 (GRCm39) K296E probably damaging Het
Vmn2r88 G A 14: 51,650,796 (GRCm39) E170K probably benign Het
Zfp740 C T 15: 102,117,184 (GRCm39) probably benign Het
Zmym5 A G 14: 57,049,618 (GRCm39) probably benign Het
Other mutations in Nos2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01388:Nos2 APN 11 78,848,278 (GRCm39) missense probably damaging 0.96
IGL01503:Nos2 APN 11 78,836,689 (GRCm39) splice site probably benign
IGL01789:Nos2 APN 11 78,835,483 (GRCm39) splice site probably benign
IGL02797:Nos2 APN 11 78,831,170 (GRCm39) missense probably damaging 1.00
IGL02968:Nos2 APN 11 78,828,463 (GRCm39) missense probably damaging 1.00
R6762_Nos2_754 UTSW 11 78,850,574 (GRCm39) missense possibly damaging 0.90
R0035:Nos2 UTSW 11 78,836,553 (GRCm39) missense probably damaging 1.00
R0265:Nos2 UTSW 11 78,828,428 (GRCm39) missense probably damaging 0.98
R0441:Nos2 UTSW 11 78,819,409 (GRCm39) missense probably benign 0.10
R0504:Nos2 UTSW 11 78,830,903 (GRCm39) missense probably damaging 1.00
R0570:Nos2 UTSW 11 78,826,187 (GRCm39) missense possibly damaging 0.49
R1356:Nos2 UTSW 11 78,843,629 (GRCm39) missense probably benign 0.00
R1538:Nos2 UTSW 11 78,847,396 (GRCm39) missense probably benign 0.00
R3414:Nos2 UTSW 11 78,848,414 (GRCm39) missense probably benign 0.14
R3418:Nos2 UTSW 11 78,850,521 (GRCm39) missense possibly damaging 0.47
R4279:Nos2 UTSW 11 78,820,602 (GRCm39) missense probably benign 0.01
R4492:Nos2 UTSW 11 78,840,921 (GRCm39) missense probably benign
R4632:Nos2 UTSW 11 78,848,417 (GRCm39) missense possibly damaging 0.95
R5038:Nos2 UTSW 11 78,813,140 (GRCm39) missense probably benign
R5214:Nos2 UTSW 11 78,846,267 (GRCm39) missense probably damaging 1.00
R5377:Nos2 UTSW 11 78,848,317 (GRCm39) missense probably benign 0.00
R5777:Nos2 UTSW 11 78,830,978 (GRCm39) missense probably null 1.00
R5834:Nos2 UTSW 11 78,819,405 (GRCm39) missense probably benign 0.01
R5930:Nos2 UTSW 11 78,828,741 (GRCm39) missense probably damaging 1.00
R6511:Nos2 UTSW 11 78,846,290 (GRCm39) splice site probably null
R6706:Nos2 UTSW 11 78,835,549 (GRCm39) missense possibly damaging 0.60
R6747:Nos2 UTSW 11 78,843,780 (GRCm39) missense probably damaging 0.99
R6762:Nos2 UTSW 11 78,850,574 (GRCm39) missense possibly damaging 0.90
R6817:Nos2 UTSW 11 78,836,092 (GRCm39) missense possibly damaging 0.64
R6868:Nos2 UTSW 11 78,848,332 (GRCm39) missense probably benign 0.02
R6917:Nos2 UTSW 11 78,842,053 (GRCm39) missense possibly damaging 0.50
R7082:Nos2 UTSW 11 78,819,405 (GRCm39) missense probably benign 0.02
R7286:Nos2 UTSW 11 78,820,680 (GRCm39) missense probably damaging 1.00
R7367:Nos2 UTSW 11 78,840,916 (GRCm39) missense possibly damaging 0.77
R7398:Nos2 UTSW 11 78,827,297 (GRCm39) nonsense probably null
R7411:Nos2 UTSW 11 78,835,681 (GRCm39) critical splice donor site probably null
R7469:Nos2 UTSW 11 78,843,797 (GRCm39) missense possibly damaging 0.94
R7736:Nos2 UTSW 11 78,813,192 (GRCm39) nonsense probably null
R8694:Nos2 UTSW 11 78,836,515 (GRCm39) missense possibly damaging 0.93
R8832:Nos2 UTSW 11 78,846,290 (GRCm39) splice site probably null
R8872:Nos2 UTSW 11 78,839,949 (GRCm39) missense probably damaging 0.99
R8952:Nos2 UTSW 11 78,836,089 (GRCm39) missense probably benign 0.00
R9433:Nos2 UTSW 11 78,850,490 (GRCm39) missense probably damaging 1.00
R9580:Nos2 UTSW 11 78,828,457 (GRCm39) missense probably benign 0.01
R9612:Nos2 UTSW 11 78,839,984 (GRCm39) missense probably damaging 1.00
R9727:Nos2 UTSW 11 78,843,825 (GRCm39) missense possibly damaging 0.51
R9747:Nos2 UTSW 11 78,822,472 (GRCm39) missense probably damaging 0.96
X0063:Nos2 UTSW 11 78,813,193 (GRCm39) missense probably benign 0.01
Z1177:Nos2 UTSW 11 78,822,498 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ACAAGATTCTCTAAGACTGGCTC -3'
(R):5'- ACTGTCTGCAACCTCCTTGG -3'

Sequencing Primer
(F):5'- TCCTGATTGGAAGCCGGGAAC -3'
(R):5'- GGCTCCCTCTGTACCCTAAG -3'
Posted On 2015-10-21