Mutagenetix > Incidental Mutation

Incidental Mutation 'R4686:Akap6'

353690

Institutional Source

Beutler Lab

Gene Symbol

Akap6

Ensembl Gene

ENSMUSG00000061603

Gene Name

A kinase (PRKA) anchor protein 6

Synonyms

MMRRC Submission

041937-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.868) question?

Stock #

R4686 (G1)

Quality Score

217

Status

Validated

Chromosome

Chromosomal Location

52699383-53155599 bp(+) (GRCm38)

Type of Mutation

frame shift

DNA Base Change (assembly)

CA to C at 52887623 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000151871 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095737] [ENSMUST00000219786]

AlphaFold

E9Q9K8

Predicted Effect

probably null
Transcript: ENSMUST00000095737

SMART Domains

Protein: ENSMUSP00000093406
Gene: ENSMUSG00000061603

Domain	Start	End	E-Value	Type
low complexity region	34	51	N/A	INTRINSIC
Blast:SPEC	66	168	2e-50	BLAST
low complexity region	441	455	N/A	INTRINSIC
low complexity region	544	555	N/A	INTRINSIC
low complexity region	569	587	N/A	INTRINSIC
low complexity region	640	651	N/A	INTRINSIC
low complexity region	694	708	N/A	INTRINSIC
SPEC	779	880	1.06e-1	SMART
SPEC	959	1057	1.45e0	SMART
SPEC	1078	1185	2.56e-2	SMART
low complexity region	1316	1332	N/A	INTRINSIC
low complexity region	1555	1568	N/A	INTRINSIC
low complexity region	1610	1622	N/A	INTRINSIC
low complexity region	1683	1698	N/A	INTRINSIC
low complexity region	1737	1781	N/A	INTRINSIC
low complexity region	1899	1910	N/A	INTRINSIC
low complexity region	2019	2031	N/A	INTRINSIC
low complexity region	2104	2115	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000219786

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 95.0%

Validation Efficiency

97% (68/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The encoded protein is highly expressed in various brain regions and cardiac and skeletal muscle. It is specifically localized to the sarcoplasmic reticulum and nuclear membrane, and is involved in anchoring PKA to the nuclear membrane or sarcoplasmic reticulum. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of this gene results in partial embryonic lethality; surviving homozygotes display a decreased body weight, craniofacial defects and reduced viability. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamtsl2	A	G	2: 27,093,825	N411S	probably damaging	Het
Adnp	A	C	2: 168,182,389	C995W	possibly damaging	Het
Ano2	T	G	6: 125,790,291	I228M	probably benign	Het
Arhgap21	T	C	2: 20,863,222	D830G	probably damaging	Het
Atp13a2	G	A	4: 141,003,276		probably null	Het
Ccdc175	C	T	12: 72,112,278	S629N	probably damaging	Het
Cdhr4	T	C	9: 107,995,684	W311R	probably benign	Het
Chaf1b	A	G	16: 93,884,584	H30R	probably benign	Het
Clnk	G	A	5: 38,741,837		probably benign	Het
Copb1	A	G	7: 114,221,736	S773P	possibly damaging	Het
Cse1l	A	G	2: 166,932,160	D198G	probably damaging	Het
Ears2	A	G	7: 122,048,204	S286P	probably damaging	Het
Efcab7	A	G	4: 99,878,116	E114G	probably benign	Het
Fanca	G	C	8: 123,268,934		probably benign	Het
Flt3	A	G	5: 147,377,048	L64P	probably damaging	Het
Gabrb1	A	G	5: 71,700,022	T3A	possibly damaging	Het
Gm10384	T	C	15: 36,871,653		noncoding transcript	Het
Gm5117	G	A	8: 31,739,256		noncoding transcript	Het
Gpr141	T	A	13: 19,751,781	I275F	probably benign	Het
Greb1l	A	T	18: 10,522,112	E736V	probably damaging	Het
Hc	T	C	2: 35,039,248	E279G	possibly damaging	Het
Hivep1	C	T	13: 42,155,850	T522M	probably benign	Het
Hspa12a	T	A	19: 58,799,749	E547V	possibly damaging	Het
Il10ra	A	G	9: 45,269,059	L5S	probably damaging	Het
Iqcf6	G	T	9: 106,627,344	W69L	probably damaging	Het
Iqgap2	T	C	13: 95,721,609	N379S	probably damaging	Het
Itpr2	A	G	6: 146,229,775	I1977T	probably damaging	Het
Kcnq1	A	T	7: 143,107,729	Y124F	probably benign	Het
Lamp5	C	T	2: 136,059,003	T41M	probably damaging	Het
Lgr5	A	G	10: 115,458,743		probably benign	Het
Mlec	A	G	5: 115,150,296	I167T	possibly damaging	Het
Myf6	A	G	10: 107,493,828	V198A	probably benign	Het
Nceh1	C	T	3: 27,241,669	R360C	probably damaging	Het
Nos2	C	A	11: 78,928,630	T56N	possibly damaging	Het
Npw	T	G	17: 24,657,412	H175P	probably benign	Het
Nrxn3	A	T	12: 89,510,651	I899F	probably damaging	Het
Ociad1	A	G	5: 73,306,735	T179A	possibly damaging	Het
Olfr378	A	G	11: 73,425,438	S182P	probably benign	Het
Olfr547	A	G	7: 102,535,149	Y134C	probably damaging	Het
Olfr912	T	A	9: 38,582,031	F251L	probably damaging	Het
Pacsin2	T	C	15: 83,381,775	N74D	probably benign	Het
Pcdh7	A	G	5: 58,129,169	I1196V	probably benign	Het
Pdxk	A	T	10: 78,447,003		probably null	Het
Phb2	G	A	6: 124,713,142		probably null	Het
Pus7l	T	A	15: 94,540,211	N251I	probably damaging	Het
Rgs7bp	T	A	13: 104,964,089	N226I	probably damaging	Het
Runx2	T	A	17: 44,639,685	D327V	probably damaging	Het
Srp68	A	T	11: 116,265,401	C172S	probably damaging	Het
Stk25	A	G	1: 93,623,420		probably null	Het
Tbrg4	C	T	11: 6,618,468	R437Q	probably benign	Het
Tedc2	C	T	17: 24,217,888		probably null	Het
Teddm1a	T	A	1: 153,892,450	I220N	probably damaging	Het
Thoc1	G	T	18: 9,970,312	E221*	probably null	Het
Tmem132d	G	T	5: 127,792,610	D553E	possibly damaging	Het
Topors	A	T	4: 40,261,694	V530D	probably benign	Het
Tpx2	T	C	2: 152,889,183	V515A	possibly damaging	Het
Trim24	A	G	6: 37,908,305	H191R	probably damaging	Het
Ttn	G	A	2: 76,737,570	R27660W	probably damaging	Het
Vmn1r203	T	C	13: 22,524,358	L103P	probably damaging	Het
Vmn1r233	C	T	17: 20,994,106	S194N	probably benign	Het
Vmn2r108	T	C	17: 20,471,374	K296E	probably damaging	Het
Vmn2r88	G	A	14: 51,413,339	E170K	probably benign	Het
Zfp740	C	T	15: 102,208,749		probably benign	Het
Zmym5	A	G	14: 56,812,161		probably benign	Het

Other mutations in Akap6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00094:Akap6	APN	12	53140980	missense	possibly damaging	0.79
IGL00505:Akap6	APN	12	52887102	missense	possibly damaging	0.92
IGL01134:Akap6	APN	12	52937217	missense	probably damaging	0.96
IGL01458:Akap6	APN	12	52886818	nonsense	probably null
IGL01589:Akap6	APN	12	53139664	missense	probably damaging	1.00
IGL01592:Akap6	APN	12	53142142	missense	probably damaging	1.00
IGL01738:Akap6	APN	12	52886817	missense	probably damaging	0.99
IGL01867:Akap6	APN	12	52888008	missense	probably damaging	1.00
IGL02025:Akap6	APN	12	53140335	missense	probably benign
IGL02041:Akap6	APN	12	53140653	missense	probably damaging	1.00
IGL02058:Akap6	APN	12	53140555	missense	probably damaging	1.00
IGL02194:Akap6	APN	12	52886823	missense	probably benign	0.00
IGL02226:Akap6	APN	12	53010467	splice site	probably benign
IGL02323:Akap6	APN	12	53140429	missense	probably benign	0.00
IGL02449:Akap6	APN	12	53140188	missense	probably damaging	1.00
IGL02475:Akap6	APN	12	53139494	missense	probably benign	0.03
IGL02546:Akap6	APN	12	52880738	missense	probably damaging	1.00
IGL02547:Akap6	APN	12	53140696	missense	probably damaging	1.00
IGL02588:Akap6	APN	12	52886499	nonsense	probably null
IGL02608:Akap6	APN	12	53010606	missense	probably benign	0.39
IGL02884:Akap6	APN	12	52886622	missense	probably benign	0.00
IGL02945:Akap6	APN	12	52880837	missense	probably damaging	1.00
IGL03029:Akap6	APN	12	52886412	missense	probably damaging	1.00
IGL03129:Akap6	APN	12	53140306	missense	probably damaging	1.00
R0133:Akap6	UTSW	12	53139471	nonsense	probably null
R0166:Akap6	UTSW	12	53140924	missense	probably benign	0.04
R0189:Akap6	UTSW	12	53141254	missense	probably benign	0.41
R0532:Akap6	UTSW	12	52887983	missense	probably benign	0.00
R0632:Akap6	UTSW	12	52937148	missense	probably damaging	1.00
R0666:Akap6	UTSW	12	52911808	missense	probably damaging	1.00
R0723:Akap6	UTSW	12	53141902	missense	probably damaging	1.00
R0763:Akap6	UTSW	12	53142214	missense	possibly damaging	0.93
R0785:Akap6	UTSW	12	52886622	missense	probably benign	0.00
R0879:Akap6	UTSW	12	52880799	missense	probably damaging	1.00
R0880:Akap6	UTSW	12	53139508	missense	possibly damaging	0.93
R1033:Akap6	UTSW	12	53069222	missense	probably damaging	0.97
R1055:Akap6	UTSW	12	52880672	nonsense	probably null
R1199:Akap6	UTSW	12	52796190	missense	probably damaging	1.00
R1295:Akap6	UTSW	12	52887029	missense	probably damaging	1.00
R1389:Akap6	UTSW	12	53139520	missense	probably benign	0.15
R1471:Akap6	UTSW	12	53141496	missense	probably benign	0.05
R1483:Akap6	UTSW	12	52796087	missense	probably damaging	1.00
R1512:Akap6	UTSW	12	52937154	missense	probably damaging	1.00
R1648:Akap6	UTSW	12	53142006	nonsense	probably null
R1791:Akap6	UTSW	12	53069125	missense	probably damaging	1.00
R1888:Akap6	UTSW	12	53142175	missense	possibly damaging	0.88
R1888:Akap6	UTSW	12	53142175	missense	possibly damaging	0.88
R1891:Akap6	UTSW	12	53142175	missense	possibly damaging	0.88
R1899:Akap6	UTSW	12	53141852	missense	possibly damaging	0.95
R1917:Akap6	UTSW	12	53104612	missense	probably benign	0.13
R1970:Akap6	UTSW	12	52938475	missense	probably damaging	0.96
R1987:Akap6	UTSW	12	53140795	missense	possibly damaging	0.78
R1988:Akap6	UTSW	12	53140795	missense	possibly damaging	0.78
R2153:Akap6	UTSW	12	53141404	missense	probably benign	0.03
R2567:Akap6	UTSW	12	52938373	missense	probably damaging	1.00
R2568:Akap6	UTSW	12	52887278	missense	possibly damaging	0.77
R3025:Akap6	UTSW	12	53140143	missense	probably benign
R3051:Akap6	UTSW	12	52887033	missense	probably damaging	1.00
R3195:Akap6	UTSW	12	53072457	nonsense	probably null
R3196:Akap6	UTSW	12	53072457	nonsense	probably null
R3426:Akap6	UTSW	12	52888034	missense	probably damaging	1.00
R3783:Akap6	UTSW	12	52880769	missense	probably damaging	1.00
R3934:Akap6	UTSW	12	53140444	missense	possibly damaging	0.92
R3936:Akap6	UTSW	12	53140444	missense	possibly damaging	0.92
R3967:Akap6	UTSW	12	53141453	missense	probably damaging	1.00
R3970:Akap6	UTSW	12	53141453	missense	probably damaging	1.00
R4042:Akap6	UTSW	12	53139379	critical splice acceptor site	probably null
R4095:Akap6	UTSW	12	53139462	missense	probably damaging	1.00
R4152:Akap6	UTSW	12	53140407	missense	probably benign	0.45
R4231:Akap6	UTSW	12	53141038	missense	probably damaging	1.00
R4232:Akap6	UTSW	12	53139671	missense	probably damaging	1.00
R4233:Akap6	UTSW	12	53139671	missense	probably damaging	1.00
R4234:Akap6	UTSW	12	53139671	missense	probably damaging	1.00
R4235:Akap6	UTSW	12	53139671	missense	probably damaging	1.00
R4236:Akap6	UTSW	12	53139671	missense	probably damaging	1.00
R4475:Akap6	UTSW	12	53141643	missense	probably benign	0.00
R4513:Akap6	UTSW	12	52796004	missense	probably benign	0.03
R4724:Akap6	UTSW	12	52795885	missense	possibly damaging	0.80
R4782:Akap6	UTSW	12	52887623	frame shift	probably null
R4852:Akap6	UTSW	12	53104675	missense	probably damaging	1.00
R5024:Akap6	UTSW	12	53142562	missense	probably benign	0.01
R5116:Akap6	UTSW	12	53141515	missense	probably benign	0.01
R5164:Akap6	UTSW	12	53142466	missense	probably benign
R5225:Akap6	UTSW	12	52886546	missense	probably damaging	1.00
R5269:Akap6	UTSW	12	53139843	missense	probably damaging	0.99
R5352:Akap6	UTSW	12	52796097	missense	probably damaging	1.00
R5496:Akap6	UTSW	12	53140653	missense	possibly damaging	0.87
R5551:Akap6	UTSW	12	52795964	missense	probably damaging	1.00
R5997:Akap6	UTSW	12	52937233	critical splice donor site	probably null
R6137:Akap6	UTSW	12	53140354	missense	probably damaging	1.00
R6151:Akap6	UTSW	12	53025792	missense	probably damaging	1.00
R6169:Akap6	UTSW	12	53142358	missense	probably benign
R6307:Akap6	UTSW	12	53141568	missense	possibly damaging	0.85
R6351:Akap6	UTSW	12	53142025	missense	probably damaging	0.98
R6479:Akap6	UTSW	12	53141169	missense	probably damaging	1.00
R6502:Akap6	UTSW	12	53140215	missense	probably damaging	1.00
R6760:Akap6	UTSW	12	53139778	missense	probably damaging	1.00
R6778:Akap6	UTSW	12	53025816	missense	probably damaging	1.00
R6837:Akap6	UTSW	12	53141262	missense	probably damaging	1.00
R6896:Akap6	UTSW	12	52887494	missense	probably benign	0.06
R6917:Akap6	UTSW	12	53069168	missense	probably null	0.97
R6983:Akap6	UTSW	12	52887653	missense	probably damaging	1.00
R7142:Akap6	UTSW	12	52887364	missense	probably benign	0.02
R7143:Akap6	UTSW	12	52887364	missense	probably benign	0.02
R7216:Akap6	UTSW	12	53140457	missense	probably benign	0.02
R7297:Akap6	UTSW	12	52887364	missense	probably benign	0.02
R7356:Akap6	UTSW	12	52911864	missense	probably damaging	1.00
R7378:Akap6	UTSW	12	53142574	missense	probably benign	0.00
R7382:Akap6	UTSW	12	53142171	missense	probably benign	0.00
R7498:Akap6	UTSW	12	53142705	nonsense	probably null
R7542:Akap6	UTSW	12	53069234	missense	probably damaging	1.00
R7589:Akap6	UTSW	12	53142063	nonsense	probably null
R7676:Akap6	UTSW	12	52886850	missense	possibly damaging	0.94
R7814:Akap6	UTSW	12	53140961	missense	probably benign	0.28
R7971:Akap6	UTSW	12	53139795	missense	probably damaging	1.00
R8039:Akap6	UTSW	12	53141676	missense	probably benign	0.00
R8425:Akap6	UTSW	12	52886621	missense	probably benign	0.00
R8747:Akap6	UTSW	12	53142216	missense	probably benign	0.01
R8885:Akap6	UTSW	12	53141536	missense	probably benign
R8956:Akap6	UTSW	12	53140344	missense	probably benign	0.00
R8989:Akap6	UTSW	12	52880871	missense	probably damaging	1.00
R9014:Akap6	UTSW	12	53139620	missense	possibly damaging	0.60
R9031:Akap6	UTSW	12	53142048	missense	probably benign	0.36
R9216:Akap6	UTSW	12	52880885	missense	probably benign	0.05
R9220:Akap6	UTSW	12	53140449	missense	possibly damaging	0.49
R9243:Akap6	UTSW	12	53141252	missense	probably benign	0.08
R9286:Akap6	UTSW	12	53072471	missense	possibly damaging	0.90
R9347:Akap6	UTSW	12	53069111	missense	probably damaging	1.00
R9475:Akap6	UTSW	12	53010552	missense	probably damaging	1.00
R9509:Akap6	UTSW	12	53142238	missense	probably damaging	0.99
R9523:Akap6	UTSW	12	52795889	missense	probably benign	0.02
R9600:Akap6	UTSW	12	52886558	missense	probably benign	0.04
R9612:Akap6	UTSW	12	52911907	missense	probably damaging	1.00
R9627:Akap6	UTSW	12	53104630	missense
R9666:Akap6	UTSW	12	53141535	missense	probably benign
R9784:Akap6	UTSW	12	53141070	missense	probably damaging	1.00
X0062:Akap6	UTSW	12	53142361	missense	probably benign	0.43
Z1176:Akap6	UTSW	12	53140444	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- CATCCCCTTGTAGTCACAGCAG -3'
(R):5'- AGATTCAATGCTCTCCCCGAG -3'

Sequencing Primer
(F):5'- ACAGCAGTGAGTCCTCTCTTGG -3'
(R):5'- TCCCCGAGAGATGAGGCTATGTC -3'

Posted On

2015-10-21