Incidental Mutation 'R4686:Rgs7bp'
ID353697
Institutional Source Beutler Lab
Gene Symbol Rgs7bp
Ensembl Gene ENSMUSG00000021719
Gene Nameregulator of G-protein signalling 7 binding protein
SynonymsD13Bwg1146e, R7bp, A930030I01Rik
MMRRC Submission 041937-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4686 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location104945904-105054930 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 104964089 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 226 (N226I)
Ref Sequence ENSEMBL: ENSMUSP00000066614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063551]
Predicted Effect probably damaging
Transcript: ENSMUST00000063551
AA Change: N226I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000066614
Gene: ENSMUSG00000021719
AA Change: N226I

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
coiled coil region 194 221 N/A INTRINSIC
Meta Mutation Damage Score 0.1451 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds to all members of the R7 subfamily of regulators of G protein signaling and regulates their translocation between the nucleus and the plasma membrane. The encoded protein could be regulated by reversible palmitoylation, which anchors it to the plasma membrane. Depalmitoylation localizes the protein to the nucleus. Polymorphisms in this gene may be associated with risk of aspirin-exacerbated respiratory disease. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit normal behavior and brain morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl2 A G 2: 27,093,825 N411S probably damaging Het
Adnp A C 2: 168,182,389 C995W possibly damaging Het
Akap6 CA C 12: 52,887,623 probably null Het
Ano2 T G 6: 125,790,291 I228M probably benign Het
Arhgap21 T C 2: 20,863,222 D830G probably damaging Het
Atp13a2 G A 4: 141,003,276 probably null Het
Ccdc175 C T 12: 72,112,278 S629N probably damaging Het
Cdhr4 T C 9: 107,995,684 W311R probably benign Het
Chaf1b A G 16: 93,884,584 H30R probably benign Het
Clnk G A 5: 38,741,837 probably benign Het
Copb1 A G 7: 114,221,736 S773P possibly damaging Het
Cse1l A G 2: 166,932,160 D198G probably damaging Het
Ears2 A G 7: 122,048,204 S286P probably damaging Het
Efcab7 A G 4: 99,878,116 E114G probably benign Het
Fanca G C 8: 123,268,934 probably benign Het
Flt3 A G 5: 147,377,048 L64P probably damaging Het
Gabrb1 A G 5: 71,700,022 T3A possibly damaging Het
Gm10384 T C 15: 36,871,653 noncoding transcript Het
Gm5117 G A 8: 31,739,256 noncoding transcript Het
Gpr141 T A 13: 19,751,781 I275F probably benign Het
Greb1l A T 18: 10,522,112 E736V probably damaging Het
Hc T C 2: 35,039,248 E279G possibly damaging Het
Hivep1 C T 13: 42,155,850 T522M probably benign Het
Hspa12a T A 19: 58,799,749 E547V possibly damaging Het
Il10ra A G 9: 45,269,059 L5S probably damaging Het
Iqcf6 G T 9: 106,627,344 W69L probably damaging Het
Iqgap2 T C 13: 95,721,609 N379S probably damaging Het
Itpr2 A G 6: 146,229,775 I1977T probably damaging Het
Kcnq1 A T 7: 143,107,729 Y124F probably benign Het
Lamp5 C T 2: 136,059,003 T41M probably damaging Het
Lgr5 A G 10: 115,458,743 probably benign Het
Mlec A G 5: 115,150,296 I167T possibly damaging Het
Myf6 A G 10: 107,493,828 V198A probably benign Het
Nceh1 C T 3: 27,241,669 R360C probably damaging Het
Nos2 C A 11: 78,928,630 T56N possibly damaging Het
Npw T G 17: 24,657,412 H175P probably benign Het
Nrxn3 A T 12: 89,510,651 I899F probably damaging Het
Ociad1 A G 5: 73,306,735 T179A possibly damaging Het
Olfr378 A G 11: 73,425,438 S182P probably benign Het
Olfr547 A G 7: 102,535,149 Y134C probably damaging Het
Olfr912 T A 9: 38,582,031 F251L probably damaging Het
Pacsin2 T C 15: 83,381,775 N74D probably benign Het
Pcdh7 A G 5: 58,129,169 I1196V probably benign Het
Pdxk A T 10: 78,447,003 probably null Het
Phb2 G A 6: 124,713,142 probably null Het
Pus7l T A 15: 94,540,211 N251I probably damaging Het
Runx2 T A 17: 44,639,685 D327V probably damaging Het
Srp68 A T 11: 116,265,401 C172S probably damaging Het
Stk25 A G 1: 93,623,420 probably null Het
Tbrg4 C T 11: 6,618,468 R437Q probably benign Het
Tedc2 C T 17: 24,217,888 probably null Het
Teddm1a T A 1: 153,892,450 I220N probably damaging Het
Thoc1 G T 18: 9,970,312 E221* probably null Het
Tmem132d G T 5: 127,792,610 D553E possibly damaging Het
Topors A T 4: 40,261,694 V530D probably benign Het
Tpx2 T C 2: 152,889,183 V515A possibly damaging Het
Trim24 A G 6: 37,908,305 H191R probably damaging Het
Ttn G A 2: 76,737,570 R27660W probably damaging Het
Vmn1r203 T C 13: 22,524,358 L103P probably damaging Het
Vmn1r233 C T 17: 20,994,106 S194N probably benign Het
Vmn2r108 T C 17: 20,471,374 K296E probably damaging Het
Vmn2r88 G A 14: 51,413,339 E170K probably benign Het
Zfp740 C T 15: 102,208,749 probably benign Het
Zmym5 A G 14: 56,812,161 probably benign Het
Other mutations in Rgs7bp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02117:Rgs7bp APN 13 104951579 missense possibly damaging 0.92
R0607:Rgs7bp UTSW 13 104967102 missense probably benign 0.02
R1938:Rgs7bp UTSW 13 104951582 missense probably damaging 1.00
R2151:Rgs7bp UTSW 13 104964089 missense probably damaging 1.00
R3932:Rgs7bp UTSW 13 105052998 missense probably benign 0.00
R3933:Rgs7bp UTSW 13 105052998 missense probably benign 0.00
R4828:Rgs7bp UTSW 13 105053024 missense possibly damaging 0.59
R4944:Rgs7bp UTSW 13 104951564 missense probably benign 0.29
R7181:Rgs7bp UTSW 13 104982874 missense possibly damaging 0.85
R7786:Rgs7bp UTSW 13 105054060 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AATGCATCTCTGTCTCCATCAG -3'
(R):5'- CTGGAGCCAAATCCTATCTGC -3'

Sequencing Primer
(F):5'- TCCATCAGAGGAGGCTCACTC -3'
(R):5'- GGAGCCAAATCCTATCTGCTATTC -3'
Posted On2015-10-21