Incidental Mutation 'R4686:Pus7l'
ID353702
Institutional Source Beutler Lab
Gene Symbol Pus7l
Ensembl Gene ENSMUSG00000033356
Gene Namepseudouridylate synthase 7-like
Synonyms
MMRRC Submission 041937-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4686 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location94522688-94543547 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 94540211 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 251 (N251I)
Ref Sequence ENSEMBL: ENSMUSP00000044075 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049151] [ENSMUST00000074936] [ENSMUST00000109248] [ENSMUST00000134061]
Predicted Effect probably damaging
Transcript: ENSMUST00000049151
AA Change: N251I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000044075
Gene: ENSMUSG00000033356
AA Change: N251I

DomainStartEndE-ValueType
Pfam:TruD 280 697 1e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000074936
SMART Domains Protein: ENSMUSP00000074471
Gene: ENSMUSG00000059883

DomainStartEndE-ValueType
PDB:1WH4|A 1 114 1e-78 PDB
Pfam:Pkinase_Tyr 187 454 3.3e-53 PFAM
Pfam:Pkinase 187 456 4.9e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109248
SMART Domains Protein: ENSMUSP00000104871
Gene: ENSMUSG00000059883

DomainStartEndE-ValueType
Pfam:Death 20 101 1.6e-6 PFAM
Pfam:Pkinase_Tyr 187 452 1.9e-51 PFAM
Pfam:Pkinase 188 452 1.3e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134061
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138306
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147832
Meta Mutation Damage Score 0.3950 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 97% (68/70)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl2 A G 2: 27,093,825 N411S probably damaging Het
Adnp A C 2: 168,182,389 C995W possibly damaging Het
Akap6 CA C 12: 52,887,623 probably null Het
Ano2 T G 6: 125,790,291 I228M probably benign Het
Arhgap21 T C 2: 20,863,222 D830G probably damaging Het
Atp13a2 G A 4: 141,003,276 probably null Het
Ccdc175 C T 12: 72,112,278 S629N probably damaging Het
Cdhr4 T C 9: 107,995,684 W311R probably benign Het
Chaf1b A G 16: 93,884,584 H30R probably benign Het
Clnk G A 5: 38,741,837 probably benign Het
Copb1 A G 7: 114,221,736 S773P possibly damaging Het
Cse1l A G 2: 166,932,160 D198G probably damaging Het
Ears2 A G 7: 122,048,204 S286P probably damaging Het
Efcab7 A G 4: 99,878,116 E114G probably benign Het
Fanca G C 8: 123,268,934 probably benign Het
Flt3 A G 5: 147,377,048 L64P probably damaging Het
Gabrb1 A G 5: 71,700,022 T3A possibly damaging Het
Gm10384 T C 15: 36,871,653 noncoding transcript Het
Gm5117 G A 8: 31,739,256 noncoding transcript Het
Gpr141 T A 13: 19,751,781 I275F probably benign Het
Greb1l A T 18: 10,522,112 E736V probably damaging Het
Hc T C 2: 35,039,248 E279G possibly damaging Het
Hivep1 C T 13: 42,155,850 T522M probably benign Het
Hspa12a T A 19: 58,799,749 E547V possibly damaging Het
Il10ra A G 9: 45,269,059 L5S probably damaging Het
Iqcf6 G T 9: 106,627,344 W69L probably damaging Het
Iqgap2 T C 13: 95,721,609 N379S probably damaging Het
Itpr2 A G 6: 146,229,775 I1977T probably damaging Het
Kcnq1 A T 7: 143,107,729 Y124F probably benign Het
Lamp5 C T 2: 136,059,003 T41M probably damaging Het
Lgr5 A G 10: 115,458,743 probably benign Het
Mlec A G 5: 115,150,296 I167T possibly damaging Het
Myf6 A G 10: 107,493,828 V198A probably benign Het
Nceh1 C T 3: 27,241,669 R360C probably damaging Het
Nos2 C A 11: 78,928,630 T56N possibly damaging Het
Npw T G 17: 24,657,412 H175P probably benign Het
Nrxn3 A T 12: 89,510,651 I899F probably damaging Het
Ociad1 A G 5: 73,306,735 T179A possibly damaging Het
Olfr378 A G 11: 73,425,438 S182P probably benign Het
Olfr547 A G 7: 102,535,149 Y134C probably damaging Het
Olfr912 T A 9: 38,582,031 F251L probably damaging Het
Pacsin2 T C 15: 83,381,775 N74D probably benign Het
Pcdh7 A G 5: 58,129,169 I1196V probably benign Het
Pdxk A T 10: 78,447,003 probably null Het
Phb2 G A 6: 124,713,142 probably null Het
Rgs7bp T A 13: 104,964,089 N226I probably damaging Het
Runx2 T A 17: 44,639,685 D327V probably damaging Het
Srp68 A T 11: 116,265,401 C172S probably damaging Het
Stk25 A G 1: 93,623,420 probably null Het
Tbrg4 C T 11: 6,618,468 R437Q probably benign Het
Tedc2 C T 17: 24,217,888 probably null Het
Teddm1a T A 1: 153,892,450 I220N probably damaging Het
Thoc1 G T 18: 9,970,312 E221* probably null Het
Tmem132d G T 5: 127,792,610 D553E possibly damaging Het
Topors A T 4: 40,261,694 V530D probably benign Het
Tpx2 T C 2: 152,889,183 V515A possibly damaging Het
Trim24 A G 6: 37,908,305 H191R probably damaging Het
Ttn G A 2: 76,737,570 R27660W probably damaging Het
Vmn1r203 T C 13: 22,524,358 L103P probably damaging Het
Vmn1r233 C T 17: 20,994,106 S194N probably benign Het
Vmn2r108 T C 17: 20,471,374 K296E probably damaging Het
Vmn2r88 G A 14: 51,413,339 E170K probably benign Het
Zfp740 C T 15: 102,208,749 probably benign Het
Zmym5 A G 14: 56,812,161 probably benign Het
Other mutations in Pus7l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01713:Pus7l APN 15 94531612 missense probably benign 0.07
IGL02049:Pus7l APN 15 94540178 missense probably damaging 1.00
IGL02484:Pus7l APN 15 94529488 missense possibly damaging 0.70
IGL02731:Pus7l APN 15 94523464 missense probably benign 0.03
IGL03252:Pus7l APN 15 94525810 missense probably benign 0.00
IGL03392:Pus7l APN 15 94536568 missense probably damaging 1.00
R0638:Pus7l UTSW 15 94523417 missense probably benign 0.20
R0848:Pus7l UTSW 15 94540512 missense probably benign 0.16
R1646:Pus7l UTSW 15 94533636 missense probably benign 0.33
R1785:Pus7l UTSW 15 94540637 missense probably benign 0.04
R2046:Pus7l UTSW 15 94540785 missense probably benign 0.01
R2206:Pus7l UTSW 15 94523590 missense probably damaging 1.00
R2210:Pus7l UTSW 15 94540292 missense possibly damaging 0.95
R3618:Pus7l UTSW 15 94527907 missense probably damaging 0.97
R4485:Pus7l UTSW 15 94523490 missense probably benign 0.00
R4487:Pus7l UTSW 15 94531617 missense possibly damaging 0.46
R4739:Pus7l UTSW 15 94540710 missense probably benign 0.02
R4975:Pus7l UTSW 15 94529488 missense possibly damaging 0.70
R5431:Pus7l UTSW 15 94529486 missense probably damaging 1.00
R5567:Pus7l UTSW 15 94527865 missense probably benign 0.00
R5570:Pus7l UTSW 15 94527865 missense probably benign 0.00
R5896:Pus7l UTSW 15 94529451 splice site probably null
R6408:Pus7l UTSW 15 94531575 missense probably benign 0.06
R6681:Pus7l UTSW 15 94527865 missense probably benign 0.00
R7344:Pus7l UTSW 15 94540617 missense probably benign 0.01
R7811:Pus7l UTSW 15 94540826 missense probably damaging 1.00
X0065:Pus7l UTSW 15 94540773 missense possibly damaging 0.87
X0066:Pus7l UTSW 15 94529493 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- GGTCCCGTTATTCAAATGATCCAC -3'
(R):5'- CAGGGTGAAGTTGTTGTAAAACC -3'

Sequencing Primer
(F):5'- GTTATTCAAATGATCCACCGTTCAC -3'
(R):5'- GTTGTTGTAAAACCAAACCGTGAGTG -3'
Posted On2015-10-21