Incidental Mutation 'R4687:Ppp1r15b'
ID353715
Institutional Source Beutler Lab
Gene Symbol Ppp1r15b
Ensembl Gene ENSMUSG00000046062
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 15b
Synonyms1810033K10Rik, CReP, C530022L24Rik
MMRRC Submission 041938-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4687 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location133131143-133139783 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 133132135 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 130 (V130A)
Ref Sequence ENSEMBL: ENSMUSP00000057062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052529]
Predicted Effect probably benign
Transcript: ENSMUST00000052529
AA Change: V130A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000057062
Gene: ENSMUSG00000046062
AA Change: V130A

DomainStartEndE-ValueType
Pfam:CReP_N 1 394 1.3e-205 PFAM
Pfam:PP1c_bdg 397 682 1.5e-154 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122956
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193049
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195676
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein phosphatase I-interacting protein that promotes the dephosphorylation of eukaryotic translation initiation factor 2A to regulate translation under conditions of cellular stress. The transcribed messenger RNA contains two upstream open reading frames (ORFs) that repress translation of the main protein coding ORF under normal conditions, while the protein coding ORF is expressed at high levels in response to stress. Continual translation of the mRNA under conditions of eukaryotic translation initiation factor 2A inactivation is thought to create a feedback loop for reactivation of the gene during recovery from stress. In addition, it has been shown that this protein plays a role in membrane traffic that is independent of translation and that it is required for exocytosis from erythroleukemia cells. Allelic variants of this gene are associated with microcephaly, short stature, and impaired glucose metabolism. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a null allele die within the first day after birth with decreased weight at birth and red blood cell counts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T A 17: 8,992,153 Y45N probably damaging Het
Agbl3 T C 6: 34,798,326 V189A probably damaging Het
Akip1 C A 7: 109,704,986 S90* probably null Het
Amn A T 12: 111,276,068 D439V probably benign Het
Arhgap17 T A 7: 123,321,603 D149V probably damaging Het
Atp6v0a4 A T 6: 38,092,465 I76N possibly damaging Het
Atp6v1h A T 1: 5,133,085 N291I probably damaging Het
Baiap2l2 G T 15: 79,259,253 P462T probably damaging Het
Bves C T 10: 45,354,840 probably null Het
Cabp7 T A 11: 4,739,265 K127* probably null Het
Cacna1h A G 17: 25,393,910 V313A possibly damaging Het
Camkk2 T C 5: 122,753,724 H245R probably damaging Het
Celsr1 T A 15: 85,932,460 S1761C possibly damaging Het
Cfap46 T C 7: 139,627,456 E1849G possibly damaging Het
Ciz1 T C 2: 32,367,465 L174P probably damaging Het
Crim1 G T 17: 78,303,025 C303F probably damaging Het
Cyp26c1 A G 19: 37,692,937 Q396R probably damaging Het
Dnajc7 G A 11: 100,599,300 P43L probably damaging Het
Dpf2 T C 19: 5,907,012 H16R probably damaging Het
Dsp A G 13: 38,191,619 T1127A probably damaging Het
Dst T C 1: 34,201,123 L1525P probably damaging Het
Ehf T A 2: 103,267,126 D192V probably damaging Het
Frem1 G T 4: 83,020,631 N71K probably damaging Het
Furin T A 7: 80,393,447 T339S probably benign Het
Gad1 T A 2: 70,600,720 I569N possibly damaging Het
Gfi1 T C 5: 107,723,810 K10R probably damaging Het
Gm20775 T A Y: 10,641,258 noncoding transcript Homo
Gpn3 A C 5: 122,378,575 D89A possibly damaging Het
Gpr18 T A 14: 121,911,678 R312* probably null Het
Gsap T C 5: 21,246,971 probably benign Het
H2-Ab1 C A 17: 34,264,809 T48K probably damaging Het
Hmcn2 A T 2: 31,438,285 N4326I probably benign Het
Igkv4-51 A C 6: 69,681,730 probably benign Het
Insr T C 8: 3,161,709 H1104R probably benign Het
Ipo13 A T 4: 117,901,576 N697K probably benign Het
Iqcm T G 8: 75,762,989 F362V probably damaging Het
Irak4 T C 15: 94,566,823 S425P probably damaging Het
Jakmip2 T C 18: 43,577,412 E242G possibly damaging Het
Kdm4a T C 4: 118,144,083 K829R probably damaging Het
Kdr T C 5: 75,968,792 N145S possibly damaging Het
Klra9 A T 6: 130,185,517 D185E probably benign Het
Lcn12 T C 2: 25,493,321 N15S probably benign Het
Mei4 T A 9: 81,927,317 M151K probably damaging Het
Mmp3 T A 9: 7,451,223 S320T probably benign Het
Mrps5 C G 2: 127,590,770 A37G probably benign Het
Mttp A G 3: 138,092,735 I800T possibly damaging Het
Nags A T 11: 102,148,196 Q451L probably damaging Het
Nbea T C 3: 56,058,065 T476A probably damaging Het
Ndufb10 T C 17: 24,722,419 E145G possibly damaging Het
Neb T G 2: 52,304,035 S660R possibly damaging Het
Nppb A G 4: 147,986,296 K43E probably benign Het
Nup188 A T 2: 30,330,633 Q906L probably benign Het
Olfr1259 T C 2: 89,943,869 D82G probably damaging Het
Olfr1413 T C 1: 92,573,330 I53T possibly damaging Het
Olfr370 T A 8: 83,541,860 S239T probably damaging Het
Olfr895 C A 9: 38,269,414 N292K probably damaging Het
Ovch2 T A 7: 107,796,548 I88F possibly damaging Het
Palm3 A G 8: 84,029,935 E692G probably benign Het
Pcsk6 T C 7: 65,983,753 F578L probably damaging Het
Piezo2 A C 18: 63,069,963 D1535E probably damaging Het
Proca1 T C 11: 78,204,898 Y32H probably damaging Het
Prtg T A 9: 72,890,798 V682E probably damaging Het
Pyroxd1 A T 6: 142,361,868 M455L probably benign Het
Rasa1 T C 13: 85,226,635 D739G possibly damaging Het
Scn3a T C 2: 65,464,730 I1550V possibly damaging Het
Sepsecs T C 5: 52,643,871 D483G probably benign Het
Setd7 T C 3: 51,550,355 D17G probably damaging Het
Sipa1l2 C T 8: 125,491,245 C451Y probably damaging Het
Slc31a1 A G 4: 62,388,702 Y165C probably damaging Het
Smg5 T C 3: 88,342,469 F68L possibly damaging Het
Sptbn5 A G 2: 120,077,208 probably benign Het
Stk3 A G 15: 35,114,565 I65T probably damaging Het
Tas2r115 C T 6: 132,737,284 A235T possibly damaging Het
Tenm2 C T 11: 36,049,097 A1400T probably benign Het
Tet1 T A 10: 62,838,791 N1169Y probably benign Het
Treml2 T A 17: 48,309,397 probably null Het
Tspan11 A G 6: 127,938,235 E104G probably damaging Het
Wdtc1 G A 4: 133,296,431 A543V probably damaging Het
Zfp148 T A 16: 33,496,819 D578E probably damaging Het
Zfp735 A T 11: 73,711,855 N542Y probably damaging Het
Zfp735 A T 11: 73,711,856 N542I probably damaging Het
Zfp869 T A 8: 69,708,143 E65D probably benign Het
Other mutations in Ppp1r15b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01935:Ppp1r15b APN 1 133132023 missense probably benign 0.15
IGL02803:Ppp1r15b APN 1 133133343 missense probably damaging 1.00
R0102:Ppp1r15b UTSW 1 133133170 missense probably damaging 1.00
R0102:Ppp1r15b UTSW 1 133133170 missense probably damaging 1.00
R0565:Ppp1r15b UTSW 1 133136653 splice site probably benign
R1513:Ppp1r15b UTSW 1 133133350 missense probably benign 0.06
R1604:Ppp1r15b UTSW 1 133132549 missense probably benign 0.21
R1932:Ppp1r15b UTSW 1 133131625 start gained probably benign
R4084:Ppp1r15b UTSW 1 133133067 missense probably damaging 1.00
R5654:Ppp1r15b UTSW 1 133131644 start gained probably benign
R6181:Ppp1r15b UTSW 1 133132523 nonsense probably null
RF018:Ppp1r15b UTSW 1 133131614 start gained probably benign
X0025:Ppp1r15b UTSW 1 133132300 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GTACTGGACCAAATTGCTTTCTCAG -3'
(R):5'- GACTAGACCAGCTTGAAGGC -3'

Sequencing Primer
(F):5'- AGCCTATTCCAGAAGCTGCTG -3'
(R):5'- CTAGACCAGCTTGAAGGCTACTG -3'
Posted On2015-10-21