Incidental Mutation 'R4687:Nup188'
ID353718
Institutional Source Beutler Lab
Gene Symbol Nup188
Ensembl Gene ENSMUSG00000052533
Gene Namenucleoporin 188
Synonyms
MMRRC Submission 041938-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R4687 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location30286397-30344266 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 30330633 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 906 (Q906L)
Ref Sequence ENSEMBL: ENSMUSP00000065836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064447]
Predicted Effect probably benign
Transcript: ENSMUST00000064447
AA Change: Q906L

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000065836
Gene: ENSMUSG00000052533
AA Change: Q906L

DomainStartEndE-ValueType
Pfam:Nup188 31 941 9.3e-213 PFAM
low complexity region 1020 1035 N/A INTRINSIC
low complexity region 1307 1320 N/A INTRINSIC
low complexity region 1330 1360 N/A INTRINSIC
low complexity region 1696 1709 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133603
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear pore complex (NPC) is found on the nuclear envelope and forms a gateway that regulates the flow of proteins and RNAs between the cytoplasm and nucleoplasm. The NPC is comprised of approximately 30 distinct proteins collectively known as nucleoporins. Nucleoporins are pore-complex-specific glycoproteins which often have cytoplasmically oriented O-linked N-acetylglucosamine residues and numerous repeats of the pentapeptide sequence XFXFG. However, the nucleoporin protein encoded by this gene does not contain the typical FG repeat sequences found in most vertebrate nucleoporins. This nucleoporin is thought to form part of the scaffold for the central channel of the nuclear pore. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T A 17: 8,992,153 Y45N probably damaging Het
Agbl3 T C 6: 34,798,326 V189A probably damaging Het
Akip1 C A 7: 109,704,986 S90* probably null Het
Amn A T 12: 111,276,068 D439V probably benign Het
Arhgap17 T A 7: 123,321,603 D149V probably damaging Het
Atp6v0a4 A T 6: 38,092,465 I76N possibly damaging Het
Atp6v1h A T 1: 5,133,085 N291I probably damaging Het
Baiap2l2 G T 15: 79,259,253 P462T probably damaging Het
Bves C T 10: 45,354,840 probably null Het
Cabp7 T A 11: 4,739,265 K127* probably null Het
Cacna1h A G 17: 25,393,910 V313A possibly damaging Het
Camkk2 T C 5: 122,753,724 H245R probably damaging Het
Celsr1 T A 15: 85,932,460 S1761C possibly damaging Het
Cfap46 T C 7: 139,627,456 E1849G possibly damaging Het
Ciz1 T C 2: 32,367,465 L174P probably damaging Het
Crim1 G T 17: 78,303,025 C303F probably damaging Het
Cyp26c1 A G 19: 37,692,937 Q396R probably damaging Het
Dnajc7 G A 11: 100,599,300 P43L probably damaging Het
Dpf2 T C 19: 5,907,012 H16R probably damaging Het
Dsp A G 13: 38,191,619 T1127A probably damaging Het
Dst T C 1: 34,201,123 L1525P probably damaging Het
Ehf T A 2: 103,267,126 D192V probably damaging Het
Frem1 G T 4: 83,020,631 N71K probably damaging Het
Furin T A 7: 80,393,447 T339S probably benign Het
Gad1 T A 2: 70,600,720 I569N possibly damaging Het
Gfi1 T C 5: 107,723,810 K10R probably damaging Het
Gm20775 T A Y: 10,641,258 noncoding transcript Homo
Gpn3 A C 5: 122,378,575 D89A possibly damaging Het
Gpr18 T A 14: 121,911,678 R312* probably null Het
Gsap T C 5: 21,246,971 probably benign Het
H2-Ab1 C A 17: 34,264,809 T48K probably damaging Het
Hmcn2 A T 2: 31,438,285 N4326I probably benign Het
Igkv4-51 A C 6: 69,681,730 probably benign Het
Insr T C 8: 3,161,709 H1104R probably benign Het
Ipo13 A T 4: 117,901,576 N697K probably benign Het
Iqcm T G 8: 75,762,989 F362V probably damaging Het
Irak4 T C 15: 94,566,823 S425P probably damaging Het
Jakmip2 T C 18: 43,577,412 E242G possibly damaging Het
Kdm4a T C 4: 118,144,083 K829R probably damaging Het
Kdr T C 5: 75,968,792 N145S possibly damaging Het
Klra9 A T 6: 130,185,517 D185E probably benign Het
Lcn12 T C 2: 25,493,321 N15S probably benign Het
Mei4 T A 9: 81,927,317 M151K probably damaging Het
Mmp3 T A 9: 7,451,223 S320T probably benign Het
Mrps5 C G 2: 127,590,770 A37G probably benign Het
Mttp A G 3: 138,092,735 I800T possibly damaging Het
Nags A T 11: 102,148,196 Q451L probably damaging Het
Nbea T C 3: 56,058,065 T476A probably damaging Het
Ndufb10 T C 17: 24,722,419 E145G possibly damaging Het
Neb T G 2: 52,304,035 S660R possibly damaging Het
Nppb A G 4: 147,986,296 K43E probably benign Het
Olfr1259 T C 2: 89,943,869 D82G probably damaging Het
Olfr1413 T C 1: 92,573,330 I53T possibly damaging Het
Olfr370 T A 8: 83,541,860 S239T probably damaging Het
Olfr895 C A 9: 38,269,414 N292K probably damaging Het
Ovch2 T A 7: 107,796,548 I88F possibly damaging Het
Palm3 A G 8: 84,029,935 E692G probably benign Het
Pcsk6 T C 7: 65,983,753 F578L probably damaging Het
Piezo2 A C 18: 63,069,963 D1535E probably damaging Het
Ppp1r15b T C 1: 133,132,135 V130A probably benign Het
Proca1 T C 11: 78,204,898 Y32H probably damaging Het
Prtg T A 9: 72,890,798 V682E probably damaging Het
Pyroxd1 A T 6: 142,361,868 M455L probably benign Het
Rasa1 T C 13: 85,226,635 D739G possibly damaging Het
Scn3a T C 2: 65,464,730 I1550V possibly damaging Het
Sepsecs T C 5: 52,643,871 D483G probably benign Het
Setd7 T C 3: 51,550,355 D17G probably damaging Het
Sipa1l2 C T 8: 125,491,245 C451Y probably damaging Het
Slc31a1 A G 4: 62,388,702 Y165C probably damaging Het
Smg5 T C 3: 88,342,469 F68L possibly damaging Het
Sptbn5 A G 2: 120,077,208 probably benign Het
Stk3 A G 15: 35,114,565 I65T probably damaging Het
Tas2r115 C T 6: 132,737,284 A235T possibly damaging Het
Tenm2 C T 11: 36,049,097 A1400T probably benign Het
Tet1 T A 10: 62,838,791 N1169Y probably benign Het
Treml2 T A 17: 48,309,397 probably null Het
Tspan11 A G 6: 127,938,235 E104G probably damaging Het
Wdtc1 G A 4: 133,296,431 A543V probably damaging Het
Zfp148 T A 16: 33,496,819 D578E probably damaging Het
Zfp735 A T 11: 73,711,855 N542Y probably damaging Het
Zfp735 A T 11: 73,711,856 N542I probably damaging Het
Zfp869 T A 8: 69,708,143 E65D probably benign Het
Other mutations in Nup188
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00908:Nup188 APN 2 30333400 missense probably damaging 0.98
IGL01599:Nup188 APN 2 30327525 missense possibly damaging 0.92
IGL01938:Nup188 APN 2 30329359 missense probably benign
IGL01973:Nup188 APN 2 30339850 missense possibly damaging 0.95
IGL02157:Nup188 APN 2 30329373 nonsense probably null
IGL02221:Nup188 APN 2 30330641 missense possibly damaging 0.75
IGL02277:Nup188 APN 2 30326511 missense possibly damaging 0.95
IGL02335:Nup188 APN 2 30323636 critical splice donor site probably null
IGL02986:Nup188 APN 2 30307633 splice site probably null
IGL03029:Nup188 APN 2 30322580 splice site probably benign
IGL03194:Nup188 APN 2 30304334 missense possibly damaging 0.95
IGL03370:Nup188 APN 2 30340641 missense possibly damaging 0.52
core UTSW 2 30339894 missense probably damaging 1.00
kern UTSW 2 30337033 missense possibly damaging 0.94
P0027:Nup188 UTSW 2 30322681 missense probably damaging 0.99
R0006:Nup188 UTSW 2 30322023 missense probably benign 0.27
R0360:Nup188 UTSW 2 30326479 missense probably null 0.93
R0373:Nup188 UTSW 2 30330988 missense probably damaging 1.00
R0645:Nup188 UTSW 2 30343466 splice site probably null
R1411:Nup188 UTSW 2 30343795 missense probably benign 0.01
R1670:Nup188 UTSW 2 30340655 missense probably benign 0.19
R2034:Nup188 UTSW 2 30310085 unclassified probably benign
R2113:Nup188 UTSW 2 30304101 nonsense probably null
R2142:Nup188 UTSW 2 30336706 missense possibly damaging 0.49
R2221:Nup188 UTSW 2 30336924 splice site probably benign
R2567:Nup188 UTSW 2 30341782 missense possibly damaging 0.53
R2964:Nup188 UTSW 2 30325346 missense probably damaging 0.98
R4006:Nup188 UTSW 2 30309878 missense probably damaging 0.99
R4007:Nup188 UTSW 2 30309878 missense probably damaging 0.99
R4079:Nup188 UTSW 2 30309878 missense probably damaging 0.99
R4480:Nup188 UTSW 2 30322129 intron probably benign
R4628:Nup188 UTSW 2 30329346 missense probably damaging 1.00
R4814:Nup188 UTSW 2 30326511 missense possibly damaging 0.95
R4834:Nup188 UTSW 2 30339584 missense probably damaging 1.00
R5038:Nup188 UTSW 2 30309220 missense probably damaging 0.98
R5056:Nup188 UTSW 2 30304131 missense probably damaging 0.98
R5124:Nup188 UTSW 2 30330935 missense probably damaging 1.00
R5256:Nup188 UTSW 2 30330749 missense probably damaging 1.00
R5284:Nup188 UTSW 2 30330635 missense probably damaging 1.00
R5548:Nup188 UTSW 2 30326493 missense probably damaging 0.99
R5560:Nup188 UTSW 2 30309885 missense probably damaging 0.99
R5668:Nup188 UTSW 2 30336324 missense probably damaging 1.00
R5769:Nup188 UTSW 2 30330735 missense probably benign 0.34
R5773:Nup188 UTSW 2 30322196 missense possibly damaging 0.92
R5774:Nup188 UTSW 2 30301048 missense probably damaging 1.00
R5827:Nup188 UTSW 2 30339847 missense probably damaging 1.00
R5919:Nup188 UTSW 2 30339894 missense probably damaging 1.00
R5923:Nup188 UTSW 2 30304090 missense probably benign
R6185:Nup188 UTSW 2 30341710 missense probably damaging 0.97
R6457:Nup188 UTSW 2 30322187 missense probably damaging 0.98
R6529:Nup188 UTSW 2 30326454 missense possibly damaging 0.95
R7002:Nup188 UTSW 2 30323568 missense probably damaging 0.99
R7195:Nup188 UTSW 2 30341830 critical splice donor site probably null
R7214:Nup188 UTSW 2 30307554 missense possibly damaging 0.71
R7345:Nup188 UTSW 2 30340601 missense probably benign 0.09
R7853:Nup188 UTSW 2 30323563 missense possibly damaging 0.95
R7998:Nup188 UTSW 2 30330971 missense probably damaging 1.00
R8012:Nup188 UTSW 2 30337265 missense possibly damaging 0.95
R8080:Nup188 UTSW 2 30337033 missense possibly damaging 0.94
R8804:Nup188 UTSW 2 30330879 missense probably benign
T0722:Nup188 UTSW 2 30322681 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CACCCCAGAAAATTATGTCTGAG -3'
(R):5'- TACAGCAGAGACAGGTGGGTATTC -3'

Sequencing Primer
(F):5'- CCCAGAAAATTATGTCTGAGTTGTTG -3'
(R):5'- TATTCAAGGGCCATGACAGC -3'
Posted On2015-10-21