Mutagenetix > Incidental Mutation

Incidental Mutation 'R4687:Nup188'

353718

Institutional Source

Beutler Lab

Gene Symbol

Nup188

Ensembl Gene

ENSMUSG00000052533

Gene Name

nucleoporin 188

Synonyms

MMRRC Submission

041938-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.955) question?

Stock #

R4687 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

30286397-30344266 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 30330633 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 906 (Q906L)

Ref Sequence

ENSEMBL: ENSMUSP00000065836 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064447]

AlphaFold

Q6ZQH8

Predicted Effect

probably benign
Transcript: ENSMUST00000064447
AA Change: Q906L

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000065836
Gene: ENSMUSG00000052533
AA Change: Q906L

Domain	Start	End	E-Value	Type
Pfam:Nup188	31	941	9.3e-213	PFAM
low complexity region	1020	1035	N/A	INTRINSIC
low complexity region	1307	1320	N/A	INTRINSIC
low complexity region	1330	1360	N/A	INTRINSIC
low complexity region	1696	1709	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133603

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear pore complex (NPC) is found on the nuclear envelope and forms a gateway that regulates the flow of proteins and RNAs between the cytoplasm and nucleoplasm. The NPC is comprised of approximately 30 distinct proteins collectively known as nucleoporins. Nucleoporins are pore-complex-specific glycoproteins which often have cytoplasmically oriented O-linked N-acetylglucosamine residues and numerous repeats of the pentapeptide sequence XFXFG. However, the nucleoporin protein encoded by this gene does not contain the typical FG repeat sequences found in most vertebrate nucleoporins. This nucleoporin is thought to form part of the scaffold for the central channel of the nuclear pore. [provided by RefSeq, Jan 2013]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700010I14Rik	T	A	17: 8,992,153	Y45N	probably damaging	Het
Agbl3	T	C	6: 34,798,326	V189A	probably damaging	Het
Akip1	C	A	7: 109,704,986	S90*	probably null	Het
Amn	A	T	12: 111,276,068	D439V	probably benign	Het
Arhgap17	T	A	7: 123,321,603	D149V	probably damaging	Het
Atp6v0a4	A	T	6: 38,092,465	I76N	possibly damaging	Het
Atp6v1h	A	T	1: 5,133,085	N291I	probably damaging	Het
Baiap2l2	G	T	15: 79,259,253	P462T	probably damaging	Het
Bves	C	T	10: 45,354,840		probably null	Het
Cabp7	T	A	11: 4,739,265	K127*	probably null	Het
Cacna1h	A	G	17: 25,393,910	V313A	possibly damaging	Het
Camkk2	T	C	5: 122,753,724	H245R	probably damaging	Het
Celsr1	T	A	15: 85,932,460	S1761C	possibly damaging	Het
Cfap46	T	C	7: 139,627,456	E1849G	possibly damaging	Het
Ciz1	T	C	2: 32,367,465	L174P	probably damaging	Het
Crim1	G	T	17: 78,303,025	C303F	probably damaging	Het
Cyp26c1	A	G	19: 37,692,937	Q396R	probably damaging	Het
Dnajc7	G	A	11: 100,599,300	P43L	probably damaging	Het
Dpf2	T	C	19: 5,907,012	H16R	probably damaging	Het
Dsp	A	G	13: 38,191,619	T1127A	probably damaging	Het
Dst	T	C	1: 34,201,123	L1525P	probably damaging	Het
Ehf	T	A	2: 103,267,126	D192V	probably damaging	Het
Frem1	G	T	4: 83,020,631	N71K	probably damaging	Het
Furin	T	A	7: 80,393,447	T339S	probably benign	Het
Gad1	T	A	2: 70,600,720	I569N	possibly damaging	Het
Gfi1	T	C	5: 107,723,810	K10R	probably damaging	Het
Gm20775	T	A	Y: 10,641,258		noncoding transcript	Homo
Gpn3	A	C	5: 122,378,575	D89A	possibly damaging	Het
Gpr18	T	A	14: 121,911,678	R312*	probably null	Het
Gsap	T	C	5: 21,246,971		probably benign	Het
H2-Ab1	C	A	17: 34,264,809	T48K	probably damaging	Het
Hmcn2	A	T	2: 31,438,285	N4326I	probably benign	Het
Igkv4-51	A	C	6: 69,681,730		probably benign	Het
Insr	T	C	8: 3,161,709	H1104R	probably benign	Het
Ipo13	A	T	4: 117,901,576	N697K	probably benign	Het
Iqcm	T	G	8: 75,762,989	F362V	probably damaging	Het
Irak4	T	C	15: 94,566,823	S425P	probably damaging	Het
Jakmip2	T	C	18: 43,577,412	E242G	possibly damaging	Het
Kdm4a	T	C	4: 118,144,083	K829R	probably damaging	Het
Kdr	T	C	5: 75,968,792	N145S	possibly damaging	Het
Klra9	A	T	6: 130,185,517	D185E	probably benign	Het
Lcn12	T	C	2: 25,493,321	N15S	probably benign	Het
Mei4	T	A	9: 81,927,317	M151K	probably damaging	Het
Mmp3	T	A	9: 7,451,223	S320T	probably benign	Het
Mrps5	C	G	2: 127,590,770	A37G	probably benign	Het
Mttp	A	G	3: 138,092,735	I800T	possibly damaging	Het
Nags	A	T	11: 102,148,196	Q451L	probably damaging	Het
Nbea	T	C	3: 56,058,065	T476A	probably damaging	Het
Ndufb10	T	C	17: 24,722,419	E145G	possibly damaging	Het
Neb	T	G	2: 52,304,035	S660R	possibly damaging	Het
Nppb	A	G	4: 147,986,296	K43E	probably benign	Het
Olfr1259	T	C	2: 89,943,869	D82G	probably damaging	Het
Olfr1413	T	C	1: 92,573,330	I53T	possibly damaging	Het
Olfr370	T	A	8: 83,541,860	S239T	probably damaging	Het
Olfr895	C	A	9: 38,269,414	N292K	probably damaging	Het
Ovch2	T	A	7: 107,796,548	I88F	possibly damaging	Het
Palm3	A	G	8: 84,029,935	E692G	probably benign	Het
Pcsk6	T	C	7: 65,983,753	F578L	probably damaging	Het
Piezo2	A	C	18: 63,069,963	D1535E	probably damaging	Het
Ppp1r15b	T	C	1: 133,132,135	V130A	probably benign	Het
Proca1	T	C	11: 78,204,898	Y32H	probably damaging	Het
Prtg	T	A	9: 72,890,798	V682E	probably damaging	Het
Pyroxd1	A	T	6: 142,361,868	M455L	probably benign	Het
Rasa1	T	C	13: 85,226,635	D739G	possibly damaging	Het
Scn3a	T	C	2: 65,464,730	I1550V	possibly damaging	Het
Sepsecs	T	C	5: 52,643,871	D483G	probably benign	Het
Setd7	T	C	3: 51,550,355	D17G	probably damaging	Het
Sipa1l2	C	T	8: 125,491,245	C451Y	probably damaging	Het
Slc31a1	A	G	4: 62,388,702	Y165C	probably damaging	Het
Smg5	T	C	3: 88,342,469	F68L	possibly damaging	Het
Sptbn5	A	G	2: 120,077,208		probably benign	Het
Stk3	A	G	15: 35,114,565	I65T	probably damaging	Het
Tas2r115	C	T	6: 132,737,284	A235T	possibly damaging	Het
Tenm2	C	T	11: 36,049,097	A1400T	probably benign	Het
Tet1	T	A	10: 62,838,791	N1169Y	probably benign	Het
Treml2	T	A	17: 48,309,397		probably null	Het
Tspan11	A	G	6: 127,938,235	E104G	probably damaging	Het
Wdtc1	G	A	4: 133,296,431	A543V	probably damaging	Het
Zfp148	T	A	16: 33,496,819	D578E	probably damaging	Het
Zfp735	A	T	11: 73,711,855	N542Y	probably damaging	Het
Zfp735	A	T	11: 73,711,856	N542I	probably damaging	Het
Zfp869	T	A	8: 69,708,143	E65D	probably benign	Het

Other mutations in Nup188

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00908:Nup188	APN	2	30333400	missense	probably damaging	0.98
IGL01599:Nup188	APN	2	30327525	missense	possibly damaging	0.92
IGL01938:Nup188	APN	2	30329359	missense	probably benign
IGL01973:Nup188	APN	2	30339850	missense	possibly damaging	0.95
IGL02157:Nup188	APN	2	30329373	nonsense	probably null
IGL02221:Nup188	APN	2	30330641	missense	possibly damaging	0.75
IGL02277:Nup188	APN	2	30326511	missense	possibly damaging	0.95
IGL02335:Nup188	APN	2	30323636	critical splice donor site	probably null
IGL02986:Nup188	APN	2	30307633	splice site	probably null
IGL03029:Nup188	APN	2	30322580	splice site	probably benign
IGL03194:Nup188	APN	2	30304334	missense	possibly damaging	0.95
IGL03370:Nup188	APN	2	30340641	missense	possibly damaging	0.52
core	UTSW	2	30339894	missense	probably damaging	1.00
kern	UTSW	2	30337033	missense	possibly damaging	0.94
P0027:Nup188	UTSW	2	30322681	missense	probably damaging	0.99
R0006:Nup188	UTSW	2	30322023	missense	probably benign	0.27
R0360:Nup188	UTSW	2	30326479	missense	probably null	0.93
R0373:Nup188	UTSW	2	30330988	missense	probably damaging	1.00
R0645:Nup188	UTSW	2	30343466	splice site	probably null
R1411:Nup188	UTSW	2	30343795	missense	probably benign	0.01
R1670:Nup188	UTSW	2	30340655	missense	probably benign	0.19
R2034:Nup188	UTSW	2	30310085	unclassified	probably benign
R2113:Nup188	UTSW	2	30304101	nonsense	probably null
R2142:Nup188	UTSW	2	30336706	missense	possibly damaging	0.49
R2221:Nup188	UTSW	2	30336924	splice site	probably benign
R2567:Nup188	UTSW	2	30341782	missense	possibly damaging	0.53
R2964:Nup188	UTSW	2	30325346	missense	probably damaging	0.98
R4006:Nup188	UTSW	2	30309878	missense	probably damaging	0.99
R4007:Nup188	UTSW	2	30309878	missense	probably damaging	0.99
R4079:Nup188	UTSW	2	30309878	missense	probably damaging	0.99
R4480:Nup188	UTSW	2	30322129	intron	probably benign
R4628:Nup188	UTSW	2	30329346	missense	probably damaging	1.00
R4814:Nup188	UTSW	2	30326511	missense	possibly damaging	0.95
R4834:Nup188	UTSW	2	30339584	missense	probably damaging	1.00
R5038:Nup188	UTSW	2	30309220	missense	probably damaging	0.98
R5056:Nup188	UTSW	2	30304131	missense	probably damaging	0.98
R5124:Nup188	UTSW	2	30330935	missense	probably damaging	1.00
R5256:Nup188	UTSW	2	30330749	missense	probably damaging	1.00
R5284:Nup188	UTSW	2	30330635	missense	probably damaging	1.00
R5548:Nup188	UTSW	2	30326493	missense	probably damaging	0.99
R5560:Nup188	UTSW	2	30309885	missense	probably damaging	0.99
R5668:Nup188	UTSW	2	30336324	missense	probably damaging	1.00
R5769:Nup188	UTSW	2	30330735	missense	probably benign	0.34
R5773:Nup188	UTSW	2	30322196	missense	possibly damaging	0.92
R5774:Nup188	UTSW	2	30301048	missense	probably damaging	1.00
R5827:Nup188	UTSW	2	30339847	missense	probably damaging	1.00
R5919:Nup188	UTSW	2	30339894	missense	probably damaging	1.00
R5923:Nup188	UTSW	2	30304090	missense	probably benign
R6185:Nup188	UTSW	2	30341710	missense	probably damaging	0.97
R6457:Nup188	UTSW	2	30322187	missense	probably damaging	0.98
R6529:Nup188	UTSW	2	30326454	missense	possibly damaging	0.95
R7002:Nup188	UTSW	2	30323568	missense	probably damaging	0.99
R7195:Nup188	UTSW	2	30341830	critical splice donor site	probably null
R7214:Nup188	UTSW	2	30307554	missense	possibly damaging	0.71
R7345:Nup188	UTSW	2	30340601	missense	probably benign	0.09
R7853:Nup188	UTSW	2	30323563	missense	possibly damaging	0.95
R7998:Nup188	UTSW	2	30330971	missense	probably damaging	1.00
R8012:Nup188	UTSW	2	30337265	missense	possibly damaging	0.95
R8080:Nup188	UTSW	2	30337033	missense	possibly damaging	0.94
R8804:Nup188	UTSW	2	30330879	missense	probably benign
R8850:Nup188	UTSW	2	30327564	missense	probably damaging	0.99
R9110:Nup188	UTSW	2	30332449	missense	possibly damaging	0.94
R9157:Nup188	UTSW	2	30298444	missense	probably benign	0.02
R9209:Nup188	UTSW	2	30342385	missense	probably benign	0.02
R9287:Nup188	UTSW	2	30336714	missense	probably damaging	0.99
R9325:Nup188	UTSW	2	30322259	missense	probably damaging	0.99
R9390:Nup188	UTSW	2	30330765	critical splice donor site	probably null
T0722:Nup188	UTSW	2	30322681	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CACCCCAGAAAATTATGTCTGAG -3'
(R):5'- TACAGCAGAGACAGGTGGGTATTC -3'

Sequencing Primer
(F):5'- CCCAGAAAATTATGTCTGAGTTGTTG -3'
(R):5'- TATTCAAGGGCCATGACAGC -3'

Posted On

2015-10-21