Mutagenetix > Incidental Mutation

Incidental Mutation 'R4687:Hmcn2'

353719

Institutional Source

Beutler Lab

Gene Symbol

Hmcn2

Ensembl Gene

ENSMUSG00000055632

Gene Name

hemicentin 2

Synonyms

MMRRC Submission

041938-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4687 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

31314415-31460738 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 31438285 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 4326 (N4326I)

Ref Sequence

ENSEMBL: ENSMUSP00000109160 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113532] [ENSMUST00000226996]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000113532
AA Change: N4326I

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000109160
Gene: ENSMUSG00000055632
AA Change: N4326I

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
VWA	37	211	1.21e-1	SMART
Blast:IG_like	263	340	2e-38	BLAST
IG	434	515	7.36e-2	SMART
IGc2	530	595	1.91e-9	SMART
IGc2	621	685	4.81e-15	SMART
IGc2	711	773	1.09e-13	SMART
IGc2	799	866	2.72e-14	SMART
IGc2	894	959	1.95e-15	SMART
IGc2	985	1049	5e-13	SMART
IGc2	1082	1147	1.09e-13	SMART
low complexity region	1151	1169	N/A	INTRINSIC
IGc2	1173	1232	7.07e-13	SMART
IGc2	1260	1326	4.31e-17	SMART
IGc2	1354	1428	3e-16	SMART
IGc2	1456	1522	1.82e-15	SMART
IGc2	1550	1615	2.7e-18	SMART
IGc2	1644	1708	1.3e-11	SMART
IGc2	1736	1801	6.69e-14	SMART
IG	1826	1917	2.31e0	SMART
IGc2	1932	1997	4.62e-17	SMART
IGc2	2024	2091	3.25e-12	SMART
IGc2	2117	2182	1.28e-10	SMART
IGc2	2209	2276	3.76e-8	SMART
IGc2	2305	2370	2.6e-11	SMART
IGc2	2399	2464	1.32e-12	SMART
IGc2	2492	2557	2.06e-14	SMART
IGc2	2588	2653	3.9e-15	SMART
IGc2	2686	2751	2.64e-12	SMART
IGc2	2797	2862	9.05e-11	SMART
IGc2	2892	2957	4.7e-9	SMART
IGc2	2984	3049	1.44e-13	SMART
IGc2	3079	3144	9.33e-13	SMART
IGc2	3171	3236	3.79e-13	SMART
IGc2	3264	3331	1.85e-16	SMART
IGc2	3360	3425	9.61e-15	SMART
low complexity region	3433	3445	N/A	INTRINSIC
IGc2	3453	3514	5.83e-14	SMART
IGc2	3542	3600	1.76e-8	SMART
low complexity region	3613	3627	N/A	INTRINSIC
IGc2	3628	3693	5.2e-11	SMART
IGc2	3719	3784	2.64e-12	SMART
IGc2	3810	3877	3.35e-5	SMART
IGc2	3903	3968	3.73e-12	SMART
IGc2	3994	4058	4.39e-9	SMART
IGc2	4084	4149	1.79e-14	SMART
low complexity region	4157	4169	N/A	INTRINSIC
IGc2	4175	4238	9.33e-13	SMART
IGc2	4265	4329	7.22e-19	SMART
IGc2	4355	4419	1.59e-15	SMART
Pfam:G2F	4431	4613	1.7e-56	PFAM
EGF_CA	4668	4708	5.78e-11	SMART
EGF_CA	4709	4753	9.39e-11	SMART
EGF_CA	4754	4796	7.69e-7	SMART
EGF_CA	4797	4837	2.19e-11	SMART
EGF_CA	4904	4943	6.74e-12	SMART
EGF_like	4944	4989	1.87e-5	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138821

Predicted Effect

probably benign
Transcript: ENSMUST00000226996

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700010I14Rik	T	A	17: 8,992,153	Y45N	probably damaging	Het
Agbl3	T	C	6: 34,798,326	V189A	probably damaging	Het
Akip1	C	A	7: 109,704,986	S90*	probably null	Het
Amn	A	T	12: 111,276,068	D439V	probably benign	Het
Arhgap17	T	A	7: 123,321,603	D149V	probably damaging	Het
Atp6v0a4	A	T	6: 38,092,465	I76N	possibly damaging	Het
Atp6v1h	A	T	1: 5,133,085	N291I	probably damaging	Het
Baiap2l2	G	T	15: 79,259,253	P462T	probably damaging	Het
Bves	C	T	10: 45,354,840		probably null	Het
Cabp7	T	A	11: 4,739,265	K127*	probably null	Het
Cacna1h	A	G	17: 25,393,910	V313A	possibly damaging	Het
Camkk2	T	C	5: 122,753,724	H245R	probably damaging	Het
Celsr1	T	A	15: 85,932,460	S1761C	possibly damaging	Het
Cfap46	T	C	7: 139,627,456	E1849G	possibly damaging	Het
Ciz1	T	C	2: 32,367,465	L174P	probably damaging	Het
Crim1	G	T	17: 78,303,025	C303F	probably damaging	Het
Cyp26c1	A	G	19: 37,692,937	Q396R	probably damaging	Het
Dnajc7	G	A	11: 100,599,300	P43L	probably damaging	Het
Dpf2	T	C	19: 5,907,012	H16R	probably damaging	Het
Dsp	A	G	13: 38,191,619	T1127A	probably damaging	Het
Dst	T	C	1: 34,201,123	L1525P	probably damaging	Het
Ehf	T	A	2: 103,267,126	D192V	probably damaging	Het
Frem1	G	T	4: 83,020,631	N71K	probably damaging	Het
Furin	T	A	7: 80,393,447	T339S	probably benign	Het
Gad1	T	A	2: 70,600,720	I569N	possibly damaging	Het
Gfi1	T	C	5: 107,723,810	K10R	probably damaging	Het
Gm20775	T	A	Y: 10,641,258		noncoding transcript	Homo
Gpn3	A	C	5: 122,378,575	D89A	possibly damaging	Het
Gpr18	T	A	14: 121,911,678	R312*	probably null	Het
Gsap	T	C	5: 21,246,971		probably benign	Het
H2-Ab1	C	A	17: 34,264,809	T48K	probably damaging	Het
Igkv4-51	A	C	6: 69,681,730		probably benign	Het
Insr	T	C	8: 3,161,709	H1104R	probably benign	Het
Ipo13	A	T	4: 117,901,576	N697K	probably benign	Het
Iqcm	T	G	8: 75,762,989	F362V	probably damaging	Het
Irak4	T	C	15: 94,566,823	S425P	probably damaging	Het
Jakmip2	T	C	18: 43,577,412	E242G	possibly damaging	Het
Kdm4a	T	C	4: 118,144,083	K829R	probably damaging	Het
Kdr	T	C	5: 75,968,792	N145S	possibly damaging	Het
Klra9	A	T	6: 130,185,517	D185E	probably benign	Het
Lcn12	T	C	2: 25,493,321	N15S	probably benign	Het
Mei4	T	A	9: 81,927,317	M151K	probably damaging	Het
Mmp3	T	A	9: 7,451,223	S320T	probably benign	Het
Mrps5	C	G	2: 127,590,770	A37G	probably benign	Het
Mttp	A	G	3: 138,092,735	I800T	possibly damaging	Het
Nags	A	T	11: 102,148,196	Q451L	probably damaging	Het
Nbea	T	C	3: 56,058,065	T476A	probably damaging	Het
Ndufb10	T	C	17: 24,722,419	E145G	possibly damaging	Het
Neb	T	G	2: 52,304,035	S660R	possibly damaging	Het
Nppb	A	G	4: 147,986,296	K43E	probably benign	Het
Nup188	A	T	2: 30,330,633	Q906L	probably benign	Het
Olfr1259	T	C	2: 89,943,869	D82G	probably damaging	Het
Olfr1413	T	C	1: 92,573,330	I53T	possibly damaging	Het
Olfr370	T	A	8: 83,541,860	S239T	probably damaging	Het
Olfr895	C	A	9: 38,269,414	N292K	probably damaging	Het
Ovch2	T	A	7: 107,796,548	I88F	possibly damaging	Het
Palm3	A	G	8: 84,029,935	E692G	probably benign	Het
Pcsk6	T	C	7: 65,983,753	F578L	probably damaging	Het
Piezo2	A	C	18: 63,069,963	D1535E	probably damaging	Het
Ppp1r15b	T	C	1: 133,132,135	V130A	probably benign	Het
Proca1	T	C	11: 78,204,898	Y32H	probably damaging	Het
Prtg	T	A	9: 72,890,798	V682E	probably damaging	Het
Pyroxd1	A	T	6: 142,361,868	M455L	probably benign	Het
Rasa1	T	C	13: 85,226,635	D739G	possibly damaging	Het
Scn3a	T	C	2: 65,464,730	I1550V	possibly damaging	Het
Sepsecs	T	C	5: 52,643,871	D483G	probably benign	Het
Setd7	T	C	3: 51,550,355	D17G	probably damaging	Het
Sipa1l2	C	T	8: 125,491,245	C451Y	probably damaging	Het
Slc31a1	A	G	4: 62,388,702	Y165C	probably damaging	Het
Smg5	T	C	3: 88,342,469	F68L	possibly damaging	Het
Sptbn5	A	G	2: 120,077,208		probably benign	Het
Stk3	A	G	15: 35,114,565	I65T	probably damaging	Het
Tas2r115	C	T	6: 132,737,284	A235T	possibly damaging	Het
Tenm2	C	T	11: 36,049,097	A1400T	probably benign	Het
Tet1	T	A	10: 62,838,791	N1169Y	probably benign	Het
Treml2	T	A	17: 48,309,397		probably null	Het
Tspan11	A	G	6: 127,938,235	E104G	probably damaging	Het
Wdtc1	G	A	4: 133,296,431	A543V	probably damaging	Het
Zfp148	T	A	16: 33,496,819	D578E	probably damaging	Het
Zfp735	A	T	11: 73,711,855	N542Y	probably damaging	Het
Zfp735	A	T	11: 73,711,856	N542I	probably damaging	Het
Zfp869	T	A	8: 69,708,143	E65D	probably benign	Het

Other mutations in Hmcn2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00965:Hmcn2	APN	2	31343096	missense	probably damaging	1.00
IGL00966:Hmcn2	APN	2	31428994	missense	probably damaging	0.97
IGL00973:Hmcn2	APN	2	31383821	intron	probably benign
IGL01364:Hmcn2	APN	2	31361814	nonsense	probably null
IGL01486:Hmcn2	APN	2	31336621	missense	probably damaging	1.00
IGL01530:Hmcn2	APN	2	31354264	missense	possibly damaging	0.85
IGL01550:Hmcn2	APN	2	31424252	missense	possibly damaging	0.84
IGL01710:Hmcn2	APN	2	31343102	missense	probably damaging	1.00
IGL01764:Hmcn2	APN	2	31405630	missense	possibly damaging	0.93
IGL01924:Hmcn2	APN	2	31398917	missense	probably benign	0.00
IGL02003:Hmcn2	APN	2	31428982	missense	possibly damaging	0.90
IGL02117:Hmcn2	APN	2	31457173	missense	possibly damaging	0.75
IGL02205:Hmcn2	APN	2	31400127	missense	probably damaging	1.00
IGL02273:Hmcn2	APN	2	31424377	missense	probably benign	0.06
IGL02313:Hmcn2	APN	2	31453605	missense	possibly damaging	0.68
IGL02326:Hmcn2	APN	2	31450952	missense	probably damaging	0.97
IGL02486:Hmcn2	APN	2	31420095	missense	probably damaging	0.98
IGL02551:Hmcn2	APN	2	31454811	missense	possibly damaging	0.83
IGL02695:Hmcn2	APN	2	31408973	missense	possibly damaging	0.87
IGL02725:Hmcn2	APN	2	31405528	missense	probably damaging	1.00
IGL02792:Hmcn2	APN	2	31346590	missense	probably damaging	1.00
IGL02882:Hmcn2	APN	2	31413367	nonsense	probably null
IGL03003:Hmcn2	APN	2	31433486	missense	probably damaging	0.98
IGL03067:Hmcn2	APN	2	31346630	missense	probably damaging	1.00
IGL03137:Hmcn2	APN	2	31362230	missense	probably damaging	0.98
IGL03220:Hmcn2	APN	2	31346621	missense	possibly damaging	0.94
IGL03411:Hmcn2	APN	2	31346637	missense	possibly damaging	0.83
PIT4544001:Hmcn2	UTSW	2	31428250	missense	probably damaging	0.98
R0044:Hmcn2	UTSW	2	31412508	missense	probably damaging	0.98
R0044:Hmcn2	UTSW	2	31412508	missense	probably damaging	0.98
R0048:Hmcn2	UTSW	2	31428237	missense	possibly damaging	0.92
R0048:Hmcn2	UTSW	2	31428237	missense	possibly damaging	0.92
R0078:Hmcn2	UTSW	2	31388344	missense	probably damaging	1.00
R0090:Hmcn2	UTSW	2	31426198	missense	probably damaging	1.00
R0173:Hmcn2	UTSW	2	31438331	critical splice donor site	probably null
R0257:Hmcn2	UTSW	2	31369164	splice site	probably benign
R0266:Hmcn2	UTSW	2	31394827	missense	probably benign	0.03
R0266:Hmcn2	UTSW	2	31445353	splice site	probably benign
R0326:Hmcn2	UTSW	2	31423225	nonsense	probably null
R0366:Hmcn2	UTSW	2	31424206	missense	possibly damaging	0.88
R0400:Hmcn2	UTSW	2	31400129	missense	probably damaging	0.98
R0412:Hmcn2	UTSW	2	31388247	missense	probably damaging	0.98
R0436:Hmcn2	UTSW	2	31405612	missense	probably damaging	1.00
R0457:Hmcn2	UTSW	2	31415284	critical splice donor site	probably null
R0487:Hmcn2	UTSW	2	31386677	missense	possibly damaging	0.60
R0568:Hmcn2	UTSW	2	31415236	missense	probably benign	0.02
R0755:Hmcn2	UTSW	2	31453160	missense	probably damaging	0.99
R0811:Hmcn2	UTSW	2	31420371	missense	probably damaging	0.99
R0812:Hmcn2	UTSW	2	31420371	missense	probably damaging	0.99
R0964:Hmcn2	UTSW	2	31391511	missense	probably benign	0.23
R0988:Hmcn2	UTSW	2	31335451	missense	probably damaging	1.00
R1484:Hmcn2	UTSW	2	31346495	missense	probably damaging	1.00
R1509:Hmcn2	UTSW	2	31314479	missense	possibly damaging	0.86
R1535:Hmcn2	UTSW	2	31420407	missense	possibly damaging	0.91
R1574:Hmcn2	UTSW	2	31404887	missense	probably damaging	0.97
R1574:Hmcn2	UTSW	2	31404887	missense	probably damaging	0.97
R1600:Hmcn2	UTSW	2	31430787	missense	probably damaging	0.98
R1623:Hmcn2	UTSW	2	31458039	missense	possibly damaging	0.84
R1692:Hmcn2	UTSW	2	31450844	missense	possibly damaging	0.47
R1719:Hmcn2	UTSW	2	31354721	missense	probably damaging	1.00
R1747:Hmcn2	UTSW	2	31457985	missense	probably benign	0.00
R1756:Hmcn2	UTSW	2	31396120	missense	probably damaging	0.99
R1763:Hmcn2	UTSW	2	31314590	missense	probably damaging	1.00
R1815:Hmcn2	UTSW	2	31393043	missense	probably damaging	0.97
R1822:Hmcn2	UTSW	2	31383692	missense	probably damaging	0.99
R1858:Hmcn2	UTSW	2	31415283	critical splice donor site	probably null
R1895:Hmcn2	UTSW	2	31405635	missense	probably damaging	0.99
R1908:Hmcn2	UTSW	2	31411910	critical splice donor site	probably null
R1946:Hmcn2	UTSW	2	31405635	missense	probably damaging	0.99
R1966:Hmcn2	UTSW	2	31389329	missense	probably damaging	0.99
R2007:Hmcn2	UTSW	2	31438255	missense	possibly damaging	0.91
R2050:Hmcn2	UTSW	2	31335436	missense	probably damaging	1.00
R2055:Hmcn2	UTSW	2	31378282	missense	probably benign	0.33
R2097:Hmcn2	UTSW	2	31380419	missense	probably damaging	1.00
R2145:Hmcn2	UTSW	2	31333931	splice site	probably benign
R2155:Hmcn2	UTSW	2	31460349	missense	possibly damaging	0.68
R2170:Hmcn2	UTSW	2	31380281	missense	probably benign	0.08
R2188:Hmcn2	UTSW	2	31419935	missense	probably benign	0.14
R2208:Hmcn2	UTSW	2	31380297	missense	probably damaging	1.00
R2217:Hmcn2	UTSW	2	31350574	missense	probably benign	0.02
R2407:Hmcn2	UTSW	2	31335412	critical splice acceptor site	probably null
R2764:Hmcn2	UTSW	2	31388298	missense	probably damaging	0.98
R2913:Hmcn2	UTSW	2	31460210	missense	possibly damaging	0.68
R2986:Hmcn2	UTSW	2	31360998	missense	probably damaging	1.00
R3157:Hmcn2	UTSW	2	31400255	missense	probably damaging	0.99
R3406:Hmcn2	UTSW	2	31433272	splice site	probably benign
R3429:Hmcn2	UTSW	2	31409144	missense	possibly damaging	0.87
R3737:Hmcn2	UTSW	2	31336612	nonsense	probably null
R3739:Hmcn2	UTSW	2	31336612	nonsense	probably null
R3771:Hmcn2	UTSW	2	31360896	missense	probably damaging	0.99
R3772:Hmcn2	UTSW	2	31360896	missense	probably damaging	0.99
R3773:Hmcn2	UTSW	2	31360896	missense	probably damaging	0.99
R3804:Hmcn2	UTSW	2	31352885	splice site	probably null
R3837:Hmcn2	UTSW	2	31413407	missense	probably damaging	0.99
R3838:Hmcn2	UTSW	2	31413407	missense	probably damaging	0.99
R3846:Hmcn2	UTSW	2	31430350	missense	possibly damaging	0.51
R3925:Hmcn2	UTSW	2	31453157	missense	probably benign	0.00
R3934:Hmcn2	UTSW	2	31380484	critical splice donor site	probably null
R3946:Hmcn2	UTSW	2	31382394	missense	possibly damaging	0.91
R4035:Hmcn2	UTSW	2	31336612	nonsense	probably null
R4057:Hmcn2	UTSW	2	31400238	missense	probably damaging	1.00
R4583:Hmcn2	UTSW	2	31413265	missense	possibly damaging	0.84
R4623:Hmcn2	UTSW	2	31396710	missense	probably damaging	1.00
R4647:Hmcn2	UTSW	2	31399019	missense	possibly damaging	0.82
R4668:Hmcn2	UTSW	2	31435792	missense	probably benign	0.40
R4669:Hmcn2	UTSW	2	31435792	missense	probably benign	0.40
R4735:Hmcn2	UTSW	2	31383775	missense	probably benign	0.06
R4772:Hmcn2	UTSW	2	31445314	missense	probably benign	0.02
R4866:Hmcn2	UTSW	2	31389391	missense	possibly damaging	0.88
R4916:Hmcn2	UTSW	2	31360980	missense	probably damaging	0.98
R4943:Hmcn2	UTSW	2	31335492	missense	probably damaging	1.00
R4967:Hmcn2	UTSW	2	31354164	critical splice acceptor site	probably null
R4973:Hmcn2	UTSW	2	31344096	missense	probably benign	0.15
R4975:Hmcn2	UTSW	2	31393025	missense	possibly damaging	0.88
R4994:Hmcn2	UTSW	2	31458055	critical splice donor site	probably null
R4997:Hmcn2	UTSW	2	31401708	missense	probably damaging	1.00
R5045:Hmcn2	UTSW	2	31409081	missense	probably damaging	1.00
R5117:Hmcn2	UTSW	2	31458049	missense	possibly damaging	0.95
R5151:Hmcn2	UTSW	2	31389443	missense	probably null
R5232:Hmcn2	UTSW	2	31457748	missense	probably damaging	0.99
R5237:Hmcn2	UTSW	2	31414716	missense	probably benign	0.01
R5288:Hmcn2	UTSW	2	31460321	missense	probably benign	0.11
R5375:Hmcn2	UTSW	2	31430441	missense	possibly damaging	0.92
R5379:Hmcn2	UTSW	2	31409011	missense	probably damaging	0.99
R5385:Hmcn2	UTSW	2	31460321	missense	probably benign	0.11
R5412:Hmcn2	UTSW	2	31346617	missense	possibly damaging	0.77
R5426:Hmcn2	UTSW	2	31336544	missense	possibly damaging	0.95
R5434:Hmcn2	UTSW	2	31420363	missense	probably damaging	1.00
R5441:Hmcn2	UTSW	2	31406416	missense	possibly damaging	0.82
R5484:Hmcn2	UTSW	2	31393054	nonsense	probably null
R5492:Hmcn2	UTSW	2	31420306	missense	probably benign	0.03
R5572:Hmcn2	UTSW	2	31414525	critical splice acceptor site	probably null
R5572:Hmcn2	UTSW	2	31414526	critical splice acceptor site	probably null
R5591:Hmcn2	UTSW	2	31344047	missense	probably damaging	1.00
R5614:Hmcn2	UTSW	2	31428303	missense	probably damaging	0.99
R5634:Hmcn2	UTSW	2	31333881	missense	probably damaging	1.00
R5645:Hmcn2	UTSW	2	31420812	missense	possibly damaging	0.92
R5716:Hmcn2	UTSW	2	31336567	missense	probably damaging	1.00
R5716:Hmcn2	UTSW	2	31458738	missense	possibly damaging	0.68
R5725:Hmcn2	UTSW	2	31383815	critical splice donor site	probably null
R5760:Hmcn2	UTSW	2	31414568	missense	possibly damaging	0.91
R5774:Hmcn2	UTSW	2	31409135	missense	possibly damaging	0.94
R5838:Hmcn2	UTSW	2	31457807	missense	probably damaging	0.99
R5899:Hmcn2	UTSW	2	31354673	missense	possibly damaging	0.93
R5916:Hmcn2	UTSW	2	31396139	missense	probably damaging	1.00
R5973:Hmcn2	UTSW	2	31420323	missense	probably damaging	0.99
R6002:Hmcn2	UTSW	2	31420309	missense	probably damaging	0.99
R6018:Hmcn2	UTSW	2	31370792	missense	probably benign	0.13
R6063:Hmcn2	UTSW	2	31434713	missense	probably benign	0.06
R6161:Hmcn2	UTSW	2	31356254	missense	probably benign
R6166:Hmcn2	UTSW	2	31369262	missense	probably damaging	1.00
R6177:Hmcn2	UTSW	2	31420106	nonsense	probably null
R6191:Hmcn2	UTSW	2	31458746	missense	probably damaging	0.99
R6195:Hmcn2	UTSW	2	31384115	missense	probably damaging	0.96
R6273:Hmcn2	UTSW	2	31411834	missense	probably damaging	0.99
R6293:Hmcn2	UTSW	2	31335451	missense	probably damaging	1.00
R6349:Hmcn2	UTSW	2	31388373	missense	probably damaging	1.00
R6395:Hmcn2	UTSW	2	31369257	missense	probably damaging	1.00
R6448:Hmcn2	UTSW	2	31420820	missense	probably benign	0.02
R6450:Hmcn2	UTSW	2	31361800	missense	probably benign	0.11
R6479:Hmcn2	UTSW	2	31425468	missense	probably damaging	0.99
R6502:Hmcn2	UTSW	2	31382478	missense	probably damaging	0.99
R6511:Hmcn2	UTSW	2	31356342	missense	possibly damaging	0.79
R6537:Hmcn2	UTSW	2	31415268	missense	probably benign	0.00
R6880:Hmcn2	UTSW	2	31343056	missense	probably damaging	1.00
R6924:Hmcn2	UTSW	2	31350505	splice site	probably null
R6971:Hmcn2	UTSW	2	31432321	missense	probably benign	0.02
R7057:Hmcn2	UTSW	2	31422649	missense	probably damaging	0.99
R7141:Hmcn2	UTSW	2	31360896	missense	probably benign	0.17
R7268:Hmcn2	UTSW	2	31457966	missense	possibly damaging	0.48
R7307:Hmcn2	UTSW	2	31343081	missense	probably damaging	0.96
R7322:Hmcn2	UTSW	2	31459081	missense	probably damaging	0.99
R7334:Hmcn2	UTSW	2	31435794	missense	probably damaging	0.98
R7334:Hmcn2	UTSW	2	31453135	missense	possibly damaging	0.82
R7335:Hmcn2	UTSW	2	31392157	missense	possibly damaging	0.88
R7358:Hmcn2	UTSW	2	31416812	missense	probably damaging	1.00
R7359:Hmcn2	UTSW	2	31388383	missense	probably benign	0.13
R7488:Hmcn2	UTSW	2	31420830	missense	probably damaging	1.00
R7498:Hmcn2	UTSW	2	31383475	splice site	probably null
R7560:Hmcn2	UTSW	2	31457173	missense	probably benign
R7566:Hmcn2	UTSW	2	31454857	missense	probably damaging	0.96
R7570:Hmcn2	UTSW	2	31423911	missense	probably benign
R7574:Hmcn2	UTSW	2	31455519	missense	possibly damaging	0.68
R7599:Hmcn2	UTSW	2	31356286	missense	possibly damaging	0.93
R7654:Hmcn2	UTSW	2	31346569	missense	probably benign	0.00
R7662:Hmcn2	UTSW	2	31382345	missense	probably benign	0.01
R7666:Hmcn2	UTSW	2	31380233	missense	probably damaging	1.00
R7698:Hmcn2	UTSW	2	31423153	missense	probably damaging	0.98
R7722:Hmcn2	UTSW	2	31382500	nonsense	probably null
R7739:Hmcn2	UTSW	2	31458026	missense	possibly damaging	0.48
R7749:Hmcn2	UTSW	2	31453033	splice site	probably null
R7828:Hmcn2	UTSW	2	31405875	missense	possibly damaging	0.95
R7912:Hmcn2	UTSW	2	31420299	missense	probably benign	0.00
R7978:Hmcn2	UTSW	2	31389347	missense	probably benign	0.40
R8075:Hmcn2	UTSW	2	31389391	missense	possibly damaging	0.88
R8088:Hmcn2	UTSW	2	31426903	nonsense	probably null
R8101:Hmcn2	UTSW	2	31350070	missense	probably benign	0.08
R8124:Hmcn2	UTSW	2	31400124	missense	probably benign	0.01
R8145:Hmcn2	UTSW	2	31423105	missense	probably damaging	1.00
R8230:Hmcn2	UTSW	2	31344473	missense	possibly damaging	0.91
R8267:Hmcn2	UTSW	2	31459179	missense	probably benign
R8277:Hmcn2	UTSW	2	31369177	missense	probably benign	0.16
R8307:Hmcn2	UTSW	2	31396115	missense	probably damaging	0.99
R8353:Hmcn2	UTSW	2	31385341	splice site	probably null
R8415:Hmcn2	UTSW	2	31391076	missense	probably benign	0.15
R8416:Hmcn2	UTSW	2	31391076	missense	probably benign	0.15
R8437:Hmcn2	UTSW	2	31391076	missense	probably benign	0.15
R8438:Hmcn2	UTSW	2	31391076	missense	probably benign	0.15
R8440:Hmcn2	UTSW	2	31391076	missense	probably benign	0.15
R8442:Hmcn2	UTSW	2	31391076	missense	probably benign	0.15
R8497:Hmcn2	UTSW	2	31423345	missense	possibly damaging	0.92
R8520:Hmcn2	UTSW	2	31354714	missense	probably damaging	1.00
R8530:Hmcn2	UTSW	2	31391076	missense	probably benign	0.15
R8537:Hmcn2	UTSW	2	31391076	missense	probably benign	0.15
R8550:Hmcn2	UTSW	2	31350642	critical splice donor site	probably null
R8721:Hmcn2	UTSW	2	31425177	missense	probably damaging	1.00
R8795:Hmcn2	UTSW	2	31425381	missense	probably benign	0.01
R8802:Hmcn2	UTSW	2	31411276	missense	probably damaging	0.97
R8804:Hmcn2	UTSW	2	31425381	missense	probably benign	0.01
R8805:Hmcn2	UTSW	2	31425381	missense	probably benign	0.01
R8904:Hmcn2	UTSW	2	31433392	missense	possibly damaging	0.92
R8937:Hmcn2	UTSW	2	31314415	start codon destroyed	probably benign	0.01
R8947:Hmcn2	UTSW	2	31388208	missense	probably damaging	0.99
R8948:Hmcn2	UTSW	2	31354729	missense	probably damaging	1.00
R8950:Hmcn2	UTSW	2	31354729	missense	probably damaging	1.00
R8959:Hmcn2	UTSW	2	31392147	missense	probably damaging	1.00
R9025:Hmcn2	UTSW	2	31457955	missense	possibly damaging	0.56
R9039:Hmcn2	UTSW	2	31354634	missense	probably damaging	0.97
R9068:Hmcn2	UTSW	2	31413673	missense	probably benign	0.01
R9161:Hmcn2	UTSW	2	31352746	missense	probably benign	0.02
R9178:Hmcn2	UTSW	2	31391509	missense	possibly damaging	0.77
R9204:Hmcn2	UTSW	2	31388365	missense	probably damaging	0.98
R9317:Hmcn2	UTSW	2	31460316	missense	possibly damaging	0.91
R9341:Hmcn2	UTSW	2	31389347	missense	probably benign	0.40
R9343:Hmcn2	UTSW	2	31389347	missense	probably benign	0.40
R9355:Hmcn2	UTSW	2	31438290	missense	probably benign	0.18
R9371:Hmcn2	UTSW	2	31411905	missense	probably damaging	1.00
R9450:Hmcn2	UTSW	2	31426833	missense	probably damaging	1.00
R9477:Hmcn2	UTSW	2	31396019	critical splice acceptor site	probably null
R9483:Hmcn2	UTSW	2	31430363	missense
R9536:Hmcn2	UTSW	2	31445118	missense	possibly damaging	0.86
R9580:Hmcn2	UTSW	2	31404863	missense	probably benign	0.16
R9593:Hmcn2	UTSW	2	31354730	missense	probably damaging	0.99
R9649:Hmcn2	UTSW	2	31402438	missense	possibly damaging	0.95
R9706:Hmcn2	UTSW	2	31415267	missense	probably benign	0.00
X0066:Hmcn2	UTSW	2	31454811	missense	possibly damaging	0.83
X0067:Hmcn2	UTSW	2	31405867	missense	possibly damaging	0.82
Z1088:Hmcn2	UTSW	2	31381067	missense	probably benign	0.01
Z1088:Hmcn2	UTSW	2	31459064	splice site	probably null
Z1176:Hmcn2	UTSW	2	31344029	missense	possibly damaging	0.95
Z1176:Hmcn2	UTSW	2	31425416	missense	probably damaging	1.00
Z1176:Hmcn2	UTSW	2	31429091	missense	probably damaging	0.97
Z1177:Hmcn2	UTSW	2	31344506	missense	probably damaging	1.00
Z1177:Hmcn2	UTSW	2	31426824	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AATAGCTGACGAATGGCCTCAG -3'
(R):5'- GCCTGAACCTGGGTTACATG -3'

Sequencing Primer
(F):5'- CGCTGCTTTCAGGATTCTTG -3'
(R):5'- GAGAAATGTTTCACTGGGCTTCTACC -3'

Posted On

2015-10-21