Mutagenetix > Incidental Mutation

Incidental Mutation 'R4687:Frem1'

353739

Institutional Source

Beutler Lab

Gene Symbol

Frem1

Ensembl Gene

ENSMUSG00000059049

Gene Name

Fras1 related extracellular matrix protein 1

Synonyms

eyes2, heb, eye, crf11, QBRICK

MMRRC Submission

041938-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.596) question?

Stock #

R4687 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

82897920-83052339 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 83020631 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 71 (N71K)

Ref Sequence

ENSEMBL: ENSMUSP00000125809 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071708] [ENSMUST00000107230] [ENSMUST00000170248]

AlphaFold

Q684R7

Predicted Effect

probably damaging
Transcript: ENSMUST00000071708
AA Change: N71K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000071627
Gene: ENSMUSG00000059049
AA Change: N71K

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
Pfam:Cadherin_3	364	508	1.7e-37	PFAM
Pfam:Cadherin_3	509	623	3.7e-18	PFAM
Pfam:Cadherin_3	592	709	8.4e-16	PFAM
Pfam:Cadherin_3	746	894	4.8e-26	PFAM
Pfam:Cadherin_3	863	1009	2.8e-30	PFAM
Pfam:Cadherin_3	1024	1115	6.4e-13	PFAM
Pfam:Cadherin_3	1119	1252	1.4e-17	PFAM
Pfam:Cadherin_3	1243	1393	8.2e-35	PFAM
Pfam:Cadherin_3	1378	1506	2e-22	PFAM
Pfam:Cadherin_3	1506	1616	1e-29	PFAM
Pfam:Cadherin_3	1617	1744	1.5e-14	PFAM
Pfam:Calx-beta	1749	1848	2.6e-10	PFAM
low complexity region	1894	1910	N/A	INTRINSIC
CLECT	2065	2188	2.25e-27	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000107230
AA Change: N71K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000102849
Gene: ENSMUSG00000059049
AA Change: N71K

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
internal_repeat_1	296	967	9.01e-39	PROSPERO
internal_repeat_1	1026	1705	9.01e-39	PROSPERO
Pfam:Calx-beta	1730	1829	6.7e-10	PFAM
low complexity region	1875	1891	N/A	INTRINSIC
CLECT	2046	2169	2.25e-27	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131102

Predicted Effect

probably damaging
Transcript: ENSMUST00000170248
AA Change: N71K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000125809
Gene: ENSMUSG00000059049
AA Change: N71K

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
Pfam:Cadherin_3	365	509	1.3e-37	PFAM
Pfam:Cadherin_3	510	623	4.5e-18	PFAM
Pfam:Cadherin_3	593	711	6.1e-16	PFAM
Pfam:Cadherin_3	728	876	2.7e-27	PFAM
Pfam:Cadherin_3	845	991	2.1e-30	PFAM
Pfam:Cadherin_3	1006	1097	4.8e-13	PFAM
Pfam:Cadherin_3	1101	1234	1e-17	PFAM
Pfam:Cadherin_3	1225	1375	6.1e-35	PFAM
Pfam:Cadherin_3	1360	1488	1.5e-22	PFAM
Pfam:Cadherin_3	1488	1598	7.5e-30	PFAM
Pfam:Cadherin_3	1599	1726	1.1e-14	PFAM
Pfam:Calx-beta	1731	1830	6.4e-10	PFAM
low complexity region	1876	1892	N/A	INTRINSIC
CLECT	2047	2170	2.25e-27	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a basement membrane protein that may play a role in craniofacial and renal development. Mutations in this gene have been associated with bifid nose with or without anorectal and renal anomalies. Alternatively spliced transcript variants encoding different isoforms have been described. PubMed ID 19940113 describes one such variant that initiates transcription within a distinct, internal exon; the resulting shorter isoform (named Toll-like/interleukin-1 receptor regulator, TILRR) is suggested to be a co-receptor of the interleukin 1 receptor family and may regulate receptor function and Toll-like receptor/interleukin 1 receptor signal transduction, contributing to the control of inflammatory response activation. [provided by RefSeq, Apr 2011]
PHENOTYPE: Homozygous mutation of this gene results in subepidermal blistering, cryptophthalmos, syndactyly, and renal agenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700010I14Rik	T	A	17: 8,992,153	Y45N	probably damaging	Het
Agbl3	T	C	6: 34,798,326	V189A	probably damaging	Het
Akip1	C	A	7: 109,704,986	S90*	probably null	Het
Amn	A	T	12: 111,276,068	D439V	probably benign	Het
Arhgap17	T	A	7: 123,321,603	D149V	probably damaging	Het
Atp6v0a4	A	T	6: 38,092,465	I76N	possibly damaging	Het
Atp6v1h	A	T	1: 5,133,085	N291I	probably damaging	Het
Baiap2l2	G	T	15: 79,259,253	P462T	probably damaging	Het
Bves	C	T	10: 45,354,840		probably null	Het
Cabp7	T	A	11: 4,739,265	K127*	probably null	Het
Cacna1h	A	G	17: 25,393,910	V313A	possibly damaging	Het
Camkk2	T	C	5: 122,753,724	H245R	probably damaging	Het
Celsr1	T	A	15: 85,932,460	S1761C	possibly damaging	Het
Cfap46	T	C	7: 139,627,456	E1849G	possibly damaging	Het
Ciz1	T	C	2: 32,367,465	L174P	probably damaging	Het
Crim1	G	T	17: 78,303,025	C303F	probably damaging	Het
Cyp26c1	A	G	19: 37,692,937	Q396R	probably damaging	Het
Dnajc7	G	A	11: 100,599,300	P43L	probably damaging	Het
Dpf2	T	C	19: 5,907,012	H16R	probably damaging	Het
Dsp	A	G	13: 38,191,619	T1127A	probably damaging	Het
Dst	T	C	1: 34,201,123	L1525P	probably damaging	Het
Ehf	T	A	2: 103,267,126	D192V	probably damaging	Het
Furin	T	A	7: 80,393,447	T339S	probably benign	Het
Gad1	T	A	2: 70,600,720	I569N	possibly damaging	Het
Gfi1	T	C	5: 107,723,810	K10R	probably damaging	Het
Gm20775	T	A	Y: 10,641,258		noncoding transcript	Homo
Gpn3	A	C	5: 122,378,575	D89A	possibly damaging	Het
Gpr18	T	A	14: 121,911,678	R312*	probably null	Het
Gsap	T	C	5: 21,246,971		probably benign	Het
H2-Ab1	C	A	17: 34,264,809	T48K	probably damaging	Het
Hmcn2	A	T	2: 31,438,285	N4326I	probably benign	Het
Igkv4-51	A	C	6: 69,681,730		probably benign	Het
Insr	T	C	8: 3,161,709	H1104R	probably benign	Het
Ipo13	A	T	4: 117,901,576	N697K	probably benign	Het
Iqcm	T	G	8: 75,762,989	F362V	probably damaging	Het
Irak4	T	C	15: 94,566,823	S425P	probably damaging	Het
Jakmip2	T	C	18: 43,577,412	E242G	possibly damaging	Het
Kdm4a	T	C	4: 118,144,083	K829R	probably damaging	Het
Kdr	T	C	5: 75,968,792	N145S	possibly damaging	Het
Klra9	A	T	6: 130,185,517	D185E	probably benign	Het
Lcn12	T	C	2: 25,493,321	N15S	probably benign	Het
Mei4	T	A	9: 81,927,317	M151K	probably damaging	Het
Mmp3	T	A	9: 7,451,223	S320T	probably benign	Het
Mrps5	C	G	2: 127,590,770	A37G	probably benign	Het
Mttp	A	G	3: 138,092,735	I800T	possibly damaging	Het
Nags	A	T	11: 102,148,196	Q451L	probably damaging	Het
Nbea	T	C	3: 56,058,065	T476A	probably damaging	Het
Ndufb10	T	C	17: 24,722,419	E145G	possibly damaging	Het
Neb	T	G	2: 52,304,035	S660R	possibly damaging	Het
Nppb	A	G	4: 147,986,296	K43E	probably benign	Het
Nup188	A	T	2: 30,330,633	Q906L	probably benign	Het
Olfr1259	T	C	2: 89,943,869	D82G	probably damaging	Het
Olfr1413	T	C	1: 92,573,330	I53T	possibly damaging	Het
Olfr370	T	A	8: 83,541,860	S239T	probably damaging	Het
Olfr895	C	A	9: 38,269,414	N292K	probably damaging	Het
Ovch2	T	A	7: 107,796,548	I88F	possibly damaging	Het
Palm3	A	G	8: 84,029,935	E692G	probably benign	Het
Pcsk6	T	C	7: 65,983,753	F578L	probably damaging	Het
Piezo2	A	C	18: 63,069,963	D1535E	probably damaging	Het
Ppp1r15b	T	C	1: 133,132,135	V130A	probably benign	Het
Proca1	T	C	11: 78,204,898	Y32H	probably damaging	Het
Prtg	T	A	9: 72,890,798	V682E	probably damaging	Het
Pyroxd1	A	T	6: 142,361,868	M455L	probably benign	Het
Rasa1	T	C	13: 85,226,635	D739G	possibly damaging	Het
Scn3a	T	C	2: 65,464,730	I1550V	possibly damaging	Het
Sepsecs	T	C	5: 52,643,871	D483G	probably benign	Het
Setd7	T	C	3: 51,550,355	D17G	probably damaging	Het
Sipa1l2	C	T	8: 125,491,245	C451Y	probably damaging	Het
Slc31a1	A	G	4: 62,388,702	Y165C	probably damaging	Het
Smg5	T	C	3: 88,342,469	F68L	possibly damaging	Het
Sptbn5	A	G	2: 120,077,208		probably benign	Het
Stk3	A	G	15: 35,114,565	I65T	probably damaging	Het
Tas2r115	C	T	6: 132,737,284	A235T	possibly damaging	Het
Tenm2	C	T	11: 36,049,097	A1400T	probably benign	Het
Tet1	T	A	10: 62,838,791	N1169Y	probably benign	Het
Treml2	T	A	17: 48,309,397		probably null	Het
Tspan11	A	G	6: 127,938,235	E104G	probably damaging	Het
Wdtc1	G	A	4: 133,296,431	A543V	probably damaging	Het
Zfp148	T	A	16: 33,496,819	D578E	probably damaging	Het
Zfp735	A	T	11: 73,711,855	N542Y	probably damaging	Het
Zfp735	A	T	11: 73,711,856	N542I	probably damaging	Het
Zfp869	T	A	8: 69,708,143	E65D	probably benign	Het

Other mutations in Frem1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00155:Frem1	APN	4	82959389	missense	possibly damaging	0.46
IGL01069:Frem1	APN	4	83013867	missense	probably benign	0.00
IGL01106:Frem1	APN	4	82922257	missense	probably benign	0.00
IGL01398:Frem1	APN	4	82950362	missense	possibly damaging	0.64
IGL01617:Frem1	APN	4	82936139	missense	probably benign	0.02
IGL01647:Frem1	APN	4	82950356	missense	possibly damaging	0.60
IGL01690:Frem1	APN	4	82959296	splice site	probably benign
IGL02006:Frem1	APN	4	82992800	critical splice donor site	probably null
IGL02069:Frem1	APN	4	82903551	missense	probably damaging	1.00
IGL02131:Frem1	APN	4	82924854	missense	probably benign	0.03
IGL02225:Frem1	APN	4	82940506	missense	probably damaging	1.00
IGL02439:Frem1	APN	4	82956345	missense	probably benign	0.00
IGL02567:Frem1	APN	4	83000055	missense	probably damaging	1.00
IGL02647:Frem1	APN	4	83001754	missense	probably damaging	1.00
IGL02653:Frem1	APN	4	82959334	missense	probably benign	0.22
IGL02831:Frem1	APN	4	82956158	missense	probably benign	0.31
IGL02997:Frem1	APN	4	82934968	missense	probably damaging	1.00
IGL03005:Frem1	APN	4	82994134	missense	probably damaging	1.00
IGL03036:Frem1	APN	4	82959339	missense	possibly damaging	0.55
IGL03193:Frem1	APN	4	82994026	splice site	probably benign
IGL03218:Frem1	APN	4	82914646	missense	probably benign	0.00
IGL03235:Frem1	APN	4	83020755	missense	possibly damaging	0.87
IGL03243:Frem1	APN	4	83013969	missense	probably damaging	1.00
bat	UTSW	4	82983060	intron	probably benign
blister	UTSW	4	83020770	missense	probably benign	0.28
boy	UTSW	4	82956255	missense	probably benign	0.16
Bubblie	UTSW	4	82970633	critical splice donor site	probably null
magicbear	UTSW	4	83001820	missense	probably damaging	1.00
major	UTSW	4	82989189	missense	probably damaging	1.00
R6324_Frem1_643	UTSW	4	82983337	missense	probably benign	0.00
PIT4131001:Frem1	UTSW	4	83005808	missense	probably damaging	0.99
PIT4466001:Frem1	UTSW	4	82972137	missense	probably benign	0.01
PIT4472001:Frem1	UTSW	4	82972137	missense	probably benign	0.01
PIT4515001:Frem1	UTSW	4	82900426	missense	probably damaging	0.98
PIT4531001:Frem1	UTSW	4	82950280	missense	probably benign	0.12
R0010:Frem1	UTSW	4	83000098	missense	probably benign	0.41
R0010:Frem1	UTSW	4	83000098	missense	probably benign	0.41
R0115:Frem1	UTSW	4	82936169	missense	possibly damaging	0.94
R0125:Frem1	UTSW	4	83011951	missense	probably damaging	1.00
R0280:Frem1	UTSW	4	82969444	missense	probably damaging	1.00
R0504:Frem1	UTSW	4	82912637	missense	probably benign	0.26
R0519:Frem1	UTSW	4	82970633	critical splice donor site	probably null
R0631:Frem1	UTSW	4	82972165	missense	probably damaging	1.00
R0645:Frem1	UTSW	4	82989166	missense	probably damaging	1.00
R0781:Frem1	UTSW	4	82950320	missense	probably damaging	0.99
R1110:Frem1	UTSW	4	82950320	missense	probably damaging	0.99
R1115:Frem1	UTSW	4	83020770	missense	probably benign	0.28
R1130:Frem1	UTSW	4	82916628	splice site	probably null
R1173:Frem1	UTSW	4	82950352	missense	probably benign	0.16
R1349:Frem1	UTSW	4	82922305	splice site	probably benign
R1464:Frem1	UTSW	4	83011879	missense	probably damaging	1.00
R1464:Frem1	UTSW	4	83011879	missense	probably damaging	1.00
R1658:Frem1	UTSW	4	83001808	missense	probably damaging	1.00
R1672:Frem1	UTSW	4	82998891	missense	probably benign	0.09
R1831:Frem1	UTSW	4	83020837	missense	possibly damaging	0.95
R1851:Frem1	UTSW	4	82950500	missense	probably damaging	0.98
R2014:Frem1	UTSW	4	83005852	missense	probably damaging	1.00
R2021:Frem1	UTSW	4	82913558	missense	probably benign	0.02
R2022:Frem1	UTSW	4	82913558	missense	probably benign	0.02
R2023:Frem1	UTSW	4	82913558	missense	probably benign	0.02
R2183:Frem1	UTSW	4	82991495	missense	probably benign	0.00
R2437:Frem1	UTSW	4	83000173	missense	probably damaging	1.00
R2520:Frem1	UTSW	4	82950290	missense	probably damaging	0.99
R3195:Frem1	UTSW	4	83014114	missense	probably damaging	0.99
R3196:Frem1	UTSW	4	83014114	missense	probably damaging	0.99
R3408:Frem1	UTSW	4	83011986	missense	probably damaging	1.00
R3411:Frem1	UTSW	4	82963179	missense	possibly damaging	0.51
R3742:Frem1	UTSW	4	83011867	missense	probably damaging	1.00
R3829:Frem1	UTSW	4	82998930	missense	probably damaging	1.00
R3888:Frem1	UTSW	4	82913607	missense	probably benign	0.41
R4329:Frem1	UTSW	4	82986537	missense	probably benign	0.01
R4364:Frem1	UTSW	4	82913251	missense	probably damaging	0.99
R4411:Frem1	UTSW	4	82963244	missense	probably damaging	1.00
R4624:Frem1	UTSW	4	82989106	missense	probably damaging	1.00
R4764:Frem1	UTSW	4	82989189	missense	probably damaging	1.00
R4801:Frem1	UTSW	4	82916628	splice site	probably benign
R4802:Frem1	UTSW	4	82916628	splice site	probably benign
R4854:Frem1	UTSW	4	82916758	missense	possibly damaging	0.88
R4872:Frem1	UTSW	4	82963150	missense	probably damaging	1.00
R4947:Frem1	UTSW	4	82966134	missense	probably damaging	0.99
R5007:Frem1	UTSW	4	82940812	intron	probably benign
R5103:Frem1	UTSW	4	82991612	missense	probably benign
R5369:Frem1	UTSW	4	83001739	missense	possibly damaging	0.61
R5494:Frem1	UTSW	4	82940753	makesense	probably null
R5694:Frem1	UTSW	4	82994116	missense	probably damaging	1.00
R5780:Frem1	UTSW	4	82950415	missense	probably benign	0.12
R5813:Frem1	UTSW	4	83000158	missense	probably damaging	1.00
R5843:Frem1	UTSW	4	82936052	missense	probably damaging	1.00
R5914:Frem1	UTSW	4	83001775	missense	probably damaging	1.00
R5985:Frem1	UTSW	4	82966050	missense	probably benign
R6091:Frem1	UTSW	4	82900559	missense	probably benign	0.01
R6165:Frem1	UTSW	4	82956255	missense	probably benign	0.16
R6324:Frem1	UTSW	4	82983337	missense	probably benign	0.00
R6369:Frem1	UTSW	4	82913792	splice site	probably null
R6414:Frem1	UTSW	4	82940536	missense	probably damaging	0.98
R6421:Frem1	UTSW	4	82994128	missense	probably damaging	1.00
R6434:Frem1	UTSW	4	82966016	missense	probably benign	0.03
R6453:Frem1	UTSW	4	82914825	nonsense	probably null
R6598:Frem1	UTSW	4	83013828	missense	probably damaging	0.99
R6720:Frem1	UTSW	4	83013832	missense	probably damaging	0.98
R6862:Frem1	UTSW	4	83012014	nonsense	probably null
R6922:Frem1	UTSW	4	82922269	missense	probably damaging	1.00
R6931:Frem1	UTSW	4	82970677	missense	probably damaging	1.00
R6992:Frem1	UTSW	4	82940362	missense	possibly damaging	0.62
R6995:Frem1	UTSW	4	82986601	missense	probably damaging	1.00
R7001:Frem1	UTSW	4	82986561	missense	probably benign	0.44
R7104:Frem1	UTSW	4	82940681	missense	probably benign	0.30
R7146:Frem1	UTSW	4	82922295	missense	possibly damaging	0.93
R7174:Frem1	UTSW	4	82922256	missense	probably benign	0.00
R7327:Frem1	UTSW	4	83020755	missense	possibly damaging	0.87
R7343:Frem1	UTSW	4	82994122	missense	probably damaging	0.99
R7368:Frem1	UTSW	4	82966144	missense	probably benign	0.19
R7392:Frem1	UTSW	4	83013827	missense	probably benign	0.06
R7465:Frem1	UTSW	4	82914835	missense	probably benign	0.11
R7499:Frem1	UTSW	4	83005770	missense	probably damaging	1.00
R7536:Frem1	UTSW	4	82956195	missense	probably damaging	1.00
R7752:Frem1	UTSW	4	82959377	missense	probably benign	0.02
R7753:Frem1	UTSW	4	82913980	missense	probably benign	0.03
R7790:Frem1	UTSW	4	82989164	missense	probably benign	0.02
R7818:Frem1	UTSW	4	83014008	missense	probably damaging	1.00
R7877:Frem1	UTSW	4	83013812	critical splice donor site	probably null
R7878:Frem1	UTSW	4	83020680	missense	probably benign	0.00
R7886:Frem1	UTSW	4	83016406	missense	possibly damaging	0.68
R7901:Frem1	UTSW	4	82959377	missense	probably benign	0.02
R7976:Frem1	UTSW	4	83001709	missense	probably damaging	0.97
R8240:Frem1	UTSW	4	82956248	missense	probably benign	0.21
R8305:Frem1	UTSW	4	82999989	missense	probably benign	0.06
R8415:Frem1	UTSW	4	83000262	missense	probably damaging	1.00
R8751:Frem1	UTSW	4	82970778	missense	probably damaging	1.00
R8819:Frem1	UTSW	4	82903517	missense	probably damaging	1.00
R8820:Frem1	UTSW	4	82903517	missense	probably damaging	1.00
R8829:Frem1	UTSW	4	83000194	missense	probably damaging	1.00
R8834:Frem1	UTSW	4	83004373	missense	probably damaging	1.00
R8857:Frem1	UTSW	4	83004043	intron	probably benign
R8910:Frem1	UTSW	4	82950457	missense	probably benign	0.09
R9036:Frem1	UTSW	4	82913548	missense	probably benign
R9228:Frem1	UTSW	4	83001820	missense	probably damaging	1.00
R9382:Frem1	UTSW	4	82983385	missense	possibly damaging	0.79
R9441:Frem1	UTSW	4	83005846	missense	probably damaging	1.00
R9492:Frem1	UTSW	4	83001820	missense	probably damaging	1.00
R9517:Frem1	UTSW	4	82983477	missense	probably damaging	1.00
R9640:Frem1	UTSW	4	82913659	missense	probably benign
R9641:Frem1	UTSW	4	82959416	missense	probably damaging	1.00
X0013:Frem1	UTSW	4	82914808	missense	probably benign	0.38
X0017:Frem1	UTSW	4	82991633	critical splice acceptor site	probably null
Z1088:Frem1	UTSW	4	82972267	missense	probably damaging	1.00
Z1176:Frem1	UTSW	4	82999983	missense	probably damaging	1.00
Z1177:Frem1	UTSW	4	82940315	critical splice donor site	probably null
Z1177:Frem1	UTSW	4	83000269	missense	probably benign	0.39
Z1177:Frem1	UTSW	4	83016464	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGACAAAAGCAATAGGATCCCATG -3'
(R):5'- ATCATGCACTCTCCAGGCTG -3'

Sequencing Primer
(F):5'- AATAGGATCCCATGCCTGTG -3'
(R):5'- CCCAAGGCTCAGTGGTTCTTG -3'

Posted On

2015-10-21