Incidental Mutation 'R4687:Ipo13'
ID 353741
Institutional Source Beutler Lab
Gene Symbol Ipo13
Ensembl Gene ENSMUSG00000033365
Gene Name importin 13
Synonyms Imp13, Kap13
MMRRC Submission 041938-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.959) question?
Stock # R4687 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 117751683-117772196 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 117758773 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 697 (N697K)
Ref Sequence ENSEMBL: ENSMUSP00000035989 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036156]
AlphaFold Q8K0C1
Predicted Effect probably benign
Transcript: ENSMUST00000036156
AA Change: N697K

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000035989
Gene: ENSMUSG00000033365
AA Change: N697K

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
IBN_N 45 111 2.05e-7 SMART
Pfam:Xpo1 116 263 4.8e-29 PFAM
low complexity region 668 692 N/A INTRINSIC
low complexity region 767 779 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134752
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153918
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the importin-beta family of nuclear transport proteins. The encoded protein mediates the import of specific cargo proteins from the cytoplasm to the nucleus and is dependent on the Ras-related nuclear protein-GTPase system. The encoded protein is also involved in nuclear export of the eukaryotic translation initiation factor 1A.[provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a gene trap insertion die prior to genotyping age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T A 17: 9,210,985 (GRCm39) Y45N probably damaging Het
Agbl3 T C 6: 34,775,261 (GRCm39) V189A probably damaging Het
Akip1 C A 7: 109,304,193 (GRCm39) S90* probably null Het
Amn A T 12: 111,242,502 (GRCm39) D439V probably benign Het
Arhgap17 T A 7: 122,920,826 (GRCm39) D149V probably damaging Het
Atp6v0a4 A T 6: 38,069,400 (GRCm39) I76N possibly damaging Het
Atp6v1h A T 1: 5,203,308 (GRCm39) N291I probably damaging Het
Baiap2l2 G T 15: 79,143,453 (GRCm39) P462T probably damaging Het
Bves C T 10: 45,230,936 (GRCm39) probably null Het
Cabp7 T A 11: 4,689,265 (GRCm39) K127* probably null Het
Cacna1h A G 17: 25,612,884 (GRCm39) V313A possibly damaging Het
Camkk2 T C 5: 122,891,787 (GRCm39) H245R probably damaging Het
Celsr1 T A 15: 85,816,661 (GRCm39) S1761C possibly damaging Het
Cfap46 T C 7: 139,207,372 (GRCm39) E1849G possibly damaging Het
Ciz1 T C 2: 32,257,477 (GRCm39) L174P probably damaging Het
Crim1 G T 17: 78,610,454 (GRCm39) C303F probably damaging Het
Cyp26c1 A G 19: 37,681,385 (GRCm39) Q396R probably damaging Het
Dnajc7 G A 11: 100,490,126 (GRCm39) P43L probably damaging Het
Dpf2 T C 19: 5,957,040 (GRCm39) H16R probably damaging Het
Dsp A G 13: 38,375,595 (GRCm39) T1127A probably damaging Het
Dst T C 1: 34,240,204 (GRCm39) L1525P probably damaging Het
Ehf T A 2: 103,097,471 (GRCm39) D192V probably damaging Het
Frem1 G T 4: 82,938,868 (GRCm39) N71K probably damaging Het
Furin T A 7: 80,043,195 (GRCm39) T339S probably benign Het
Gad1 T A 2: 70,431,064 (GRCm39) I569N possibly damaging Het
Gfi1 T C 5: 107,871,676 (GRCm39) K10R probably damaging Het
Gm20775 T A Y: 10,641,258 (GRCm39) noncoding transcript Homo
Gpn3 A C 5: 122,516,638 (GRCm39) D89A possibly damaging Het
Gpr18 T A 14: 122,149,090 (GRCm39) R312* probably null Het
Gsap T C 5: 21,451,969 (GRCm39) probably benign Het
H2-Ab1 C A 17: 34,483,783 (GRCm39) T48K probably damaging Het
Hmcn2 A T 2: 31,328,297 (GRCm39) N4326I probably benign Het
Igkv4-51 A C 6: 69,658,714 (GRCm39) probably benign Het
Insr T C 8: 3,211,709 (GRCm39) H1104R probably benign Het
Iqcm T G 8: 76,489,617 (GRCm39) F362V probably damaging Het
Irak4 T C 15: 94,464,704 (GRCm39) S425P probably damaging Het
Jakmip2 T C 18: 43,710,477 (GRCm39) E242G possibly damaging Het
Kdm4a T C 4: 118,001,280 (GRCm39) K829R probably damaging Het
Kdr T C 5: 76,129,452 (GRCm39) N145S possibly damaging Het
Klra9 A T 6: 130,162,480 (GRCm39) D185E probably benign Het
Lcn12 T C 2: 25,383,333 (GRCm39) N15S probably benign Het
Mei4 T A 9: 81,809,370 (GRCm39) M151K probably damaging Het
Mmp3 T A 9: 7,451,223 (GRCm39) S320T probably benign Het
Mrps5 C G 2: 127,432,690 (GRCm39) A37G probably benign Het
Mttp A G 3: 137,798,496 (GRCm39) I800T possibly damaging Het
Nags A T 11: 102,039,022 (GRCm39) Q451L probably damaging Het
Nbea T C 3: 55,965,486 (GRCm39) T476A probably damaging Het
Ndufb10 T C 17: 24,941,393 (GRCm39) E145G possibly damaging Het
Neb T G 2: 52,194,047 (GRCm39) S660R possibly damaging Het
Nppb A G 4: 148,070,753 (GRCm39) K43E probably benign Het
Nup188 A T 2: 30,220,645 (GRCm39) Q906L probably benign Het
Or10k2 T A 8: 84,268,489 (GRCm39) S239T probably damaging Het
Or4c12 T C 2: 89,774,213 (GRCm39) D82G probably damaging Het
Or8c17 C A 9: 38,180,710 (GRCm39) N292K probably damaging Het
Or9s23 T C 1: 92,501,052 (GRCm39) I53T possibly damaging Het
Ovch2 T A 7: 107,395,755 (GRCm39) I88F possibly damaging Het
Palm3 A G 8: 84,756,564 (GRCm39) E692G probably benign Het
Pcsk6 T C 7: 65,633,501 (GRCm39) F578L probably damaging Het
Piezo2 A C 18: 63,203,034 (GRCm39) D1535E probably damaging Het
Ppp1r15b T C 1: 133,059,873 (GRCm39) V130A probably benign Het
Proca1 T C 11: 78,095,724 (GRCm39) Y32H probably damaging Het
Prtg T A 9: 72,798,080 (GRCm39) V682E probably damaging Het
Pyroxd1 A T 6: 142,307,594 (GRCm39) M455L probably benign Het
Rasa1 T C 13: 85,374,754 (GRCm39) D739G possibly damaging Het
Scn3a T C 2: 65,295,074 (GRCm39) I1550V possibly damaging Het
Sepsecs T C 5: 52,801,213 (GRCm39) D483G probably benign Het
Setd7 T C 3: 51,457,776 (GRCm39) D17G probably damaging Het
Sipa1l2 C T 8: 126,217,984 (GRCm39) C451Y probably damaging Het
Slc31a1 A G 4: 62,306,939 (GRCm39) Y165C probably damaging Het
Smg5 T C 3: 88,249,776 (GRCm39) F68L possibly damaging Het
Sptbn5 A G 2: 119,907,689 (GRCm39) probably benign Het
Stk3 A G 15: 35,114,711 (GRCm39) I65T probably damaging Het
Tas2r115 C T 6: 132,714,247 (GRCm39) A235T possibly damaging Het
Tenm2 C T 11: 35,939,924 (GRCm39) A1400T probably benign Het
Tet1 T A 10: 62,674,570 (GRCm39) N1169Y probably benign Het
Treml2 T A 17: 48,616,425 (GRCm39) probably null Het
Tspan11 A G 6: 127,915,198 (GRCm39) E104G probably damaging Het
Wdtc1 G A 4: 133,023,742 (GRCm39) A543V probably damaging Het
Zfp148 T A 16: 33,317,189 (GRCm39) D578E probably damaging Het
Zfp735 A T 11: 73,602,682 (GRCm39) N542I probably damaging Het
Zfp735 A T 11: 73,602,681 (GRCm39) N542Y probably damaging Het
Zfp869 T A 8: 70,160,793 (GRCm39) E65D probably benign Het
Other mutations in Ipo13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Ipo13 APN 4 117,760,602 (GRCm39) missense probably benign 0.10
IGL00800:Ipo13 APN 4 117,769,505 (GRCm39) missense probably benign 0.31
IGL00971:Ipo13 APN 4 117,771,564 (GRCm39) missense possibly damaging 0.83
IGL01552:Ipo13 APN 4 117,758,161 (GRCm39) missense probably benign 0.16
IGL01957:Ipo13 APN 4 117,761,078 (GRCm39) missense probably damaging 0.99
IGL02262:Ipo13 APN 4 117,761,010 (GRCm39) missense probably damaging 1.00
R0109:Ipo13 UTSW 4 117,762,213 (GRCm39) missense possibly damaging 0.92
R0142:Ipo13 UTSW 4 117,762,766 (GRCm39) missense probably damaging 1.00
R0771:Ipo13 UTSW 4 117,751,843 (GRCm39) missense possibly damaging 0.78
R1248:Ipo13 UTSW 4 117,758,228 (GRCm39) missense probably damaging 1.00
R1381:Ipo13 UTSW 4 117,761,592 (GRCm39) missense probably damaging 1.00
R1497:Ipo13 UTSW 4 117,761,856 (GRCm39) missense probably benign 0.04
R1614:Ipo13 UTSW 4 117,761,815 (GRCm39) missense probably benign 0.00
R1711:Ipo13 UTSW 4 117,761,719 (GRCm39) missense probably benign 0.38
R2037:Ipo13 UTSW 4 117,761,858 (GRCm39) nonsense probably null
R2200:Ipo13 UTSW 4 117,762,100 (GRCm39) critical splice donor site probably null
R3698:Ipo13 UTSW 4 117,757,890 (GRCm39) missense probably damaging 1.00
R3949:Ipo13 UTSW 4 117,758,239 (GRCm39) missense probably benign 0.10
R4894:Ipo13 UTSW 4 117,761,687 (GRCm39) missense possibly damaging 0.84
R4894:Ipo13 UTSW 4 117,760,638 (GRCm39) missense probably damaging 0.99
R4956:Ipo13 UTSW 4 117,758,768 (GRCm39) missense probably benign 0.00
R5679:Ipo13 UTSW 4 117,752,029 (GRCm39) missense probably damaging 1.00
R5879:Ipo13 UTSW 4 117,760,400 (GRCm39) missense possibly damaging 0.67
R5921:Ipo13 UTSW 4 117,769,286 (GRCm39) missense probably benign 0.14
R6250:Ipo13 UTSW 4 117,769,351 (GRCm39) missense possibly damaging 0.93
R6875:Ipo13 UTSW 4 117,762,108 (GRCm39) missense possibly damaging 0.90
R7178:Ipo13 UTSW 4 117,761,081 (GRCm39) missense possibly damaging 0.83
R7412:Ipo13 UTSW 4 117,752,068 (GRCm39) missense probably benign
R7687:Ipo13 UTSW 4 117,769,088 (GRCm39) missense probably benign 0.01
R7774:Ipo13 UTSW 4 117,771,494 (GRCm39) missense probably benign 0.11
R8390:Ipo13 UTSW 4 117,769,534 (GRCm39) missense probably damaging 0.99
R8489:Ipo13 UTSW 4 117,758,219 (GRCm39) missense probably damaging 0.98
R8525:Ipo13 UTSW 4 117,762,126 (GRCm39) missense probably damaging 0.99
R9039:Ipo13 UTSW 4 117,758,185 (GRCm39) missense probably damaging 0.98
R9229:Ipo13 UTSW 4 117,758,801 (GRCm39) missense probably damaging 0.96
R9319:Ipo13 UTSW 4 117,769,585 (GRCm39) missense probably benign 0.00
R9760:Ipo13 UTSW 4 117,762,778 (GRCm39) missense probably benign 0.05
Z1088:Ipo13 UTSW 4 117,761,877 (GRCm39) missense probably benign 0.14
Z1176:Ipo13 UTSW 4 117,761,827 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTTCTGTGATACTGGAGCAG -3'
(R):5'- ACATCATCTCTTGCCCCAGG -3'

Sequencing Primer
(F):5'- ATACTGGAGCAGTGGTGGTC -3'
(R):5'- AGGTCCCAAATCCTCAGTGTG -3'
Posted On 2015-10-21