Mutagenetix > Incidental Mutation

Incidental Mutation 'R4687:Ipo13'

353741

Institutional Source

Beutler Lab

Gene Symbol

Ipo13

Ensembl Gene

ENSMUSG00000033365

Gene Name

importin 13

Synonyms

Kap13

MMRRC Submission

041938-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.962) question?

Stock #

R4687 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

117894486-117914999 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 117901576 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 697 (N697K)

Ref Sequence

ENSEMBL: ENSMUSP00000035989 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036156]

AlphaFold

Q8K0C1

Predicted Effect

probably benign
Transcript: ENSMUST00000036156
AA Change: N697K

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000035989
Gene: ENSMUSG00000033365
AA Change: N697K

Domain	Start	End	E-Value	Type
low complexity region	9	18	N/A	INTRINSIC
IBN_N	45	111	2.05e-7	SMART
Pfam:Xpo1	116	263	4.8e-29	PFAM
low complexity region	668	692	N/A	INTRINSIC
low complexity region	767	779	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134752

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153918

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the importin-beta family of nuclear transport proteins. The encoded protein mediates the import of specific cargo proteins from the cytoplasm to the nucleus and is dependent on the Ras-related nuclear protein-GTPase system. The encoded protein is also involved in nuclear export of the eukaryotic translation initiation factor 1A.[provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a gene trap insertion die prior to genotyping age. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700010I14Rik	T	A	17: 8,992,153	Y45N	probably damaging	Het
Agbl3	T	C	6: 34,798,326	V189A	probably damaging	Het
Akip1	C	A	7: 109,704,986	S90*	probably null	Het
Amn	A	T	12: 111,276,068	D439V	probably benign	Het
Arhgap17	T	A	7: 123,321,603	D149V	probably damaging	Het
Atp6v0a4	A	T	6: 38,092,465	I76N	possibly damaging	Het
Atp6v1h	A	T	1: 5,133,085	N291I	probably damaging	Het
Baiap2l2	G	T	15: 79,259,253	P462T	probably damaging	Het
Bves	C	T	10: 45,354,840		probably null	Het
Cabp7	T	A	11: 4,739,265	K127*	probably null	Het
Cacna1h	A	G	17: 25,393,910	V313A	possibly damaging	Het
Camkk2	T	C	5: 122,753,724	H245R	probably damaging	Het
Celsr1	T	A	15: 85,932,460	S1761C	possibly damaging	Het
Cfap46	T	C	7: 139,627,456	E1849G	possibly damaging	Het
Ciz1	T	C	2: 32,367,465	L174P	probably damaging	Het
Crim1	G	T	17: 78,303,025	C303F	probably damaging	Het
Cyp26c1	A	G	19: 37,692,937	Q396R	probably damaging	Het
Dnajc7	G	A	11: 100,599,300	P43L	probably damaging	Het
Dpf2	T	C	19: 5,907,012	H16R	probably damaging	Het
Dsp	A	G	13: 38,191,619	T1127A	probably damaging	Het
Dst	T	C	1: 34,201,123	L1525P	probably damaging	Het
Ehf	T	A	2: 103,267,126	D192V	probably damaging	Het
Frem1	G	T	4: 83,020,631	N71K	probably damaging	Het
Furin	T	A	7: 80,393,447	T339S	probably benign	Het
Gad1	T	A	2: 70,600,720	I569N	possibly damaging	Het
Gfi1	T	C	5: 107,723,810	K10R	probably damaging	Het
Gm20775	T	A	Y: 10,641,258		noncoding transcript	Homo
Gpn3	A	C	5: 122,378,575	D89A	possibly damaging	Het
Gpr18	T	A	14: 121,911,678	R312*	probably null	Het
Gsap	T	C	5: 21,246,971		probably benign	Het
H2-Ab1	C	A	17: 34,264,809	T48K	probably damaging	Het
Hmcn2	A	T	2: 31,438,285	N4326I	probably benign	Het
Igkv4-51	A	C	6: 69,681,730		probably benign	Het
Insr	T	C	8: 3,161,709	H1104R	probably benign	Het
Iqcm	T	G	8: 75,762,989	F362V	probably damaging	Het
Irak4	T	C	15: 94,566,823	S425P	probably damaging	Het
Jakmip2	T	C	18: 43,577,412	E242G	possibly damaging	Het
Kdm4a	T	C	4: 118,144,083	K829R	probably damaging	Het
Kdr	T	C	5: 75,968,792	N145S	possibly damaging	Het
Klra9	A	T	6: 130,185,517	D185E	probably benign	Het
Lcn12	T	C	2: 25,493,321	N15S	probably benign	Het
Mei4	T	A	9: 81,927,317	M151K	probably damaging	Het
Mmp3	T	A	9: 7,451,223	S320T	probably benign	Het
Mrps5	C	G	2: 127,590,770	A37G	probably benign	Het
Mttp	A	G	3: 138,092,735	I800T	possibly damaging	Het
Nags	A	T	11: 102,148,196	Q451L	probably damaging	Het
Nbea	T	C	3: 56,058,065	T476A	probably damaging	Het
Ndufb10	T	C	17: 24,722,419	E145G	possibly damaging	Het
Neb	T	G	2: 52,304,035	S660R	possibly damaging	Het
Nppb	A	G	4: 147,986,296	K43E	probably benign	Het
Nup188	A	T	2: 30,330,633	Q906L	probably benign	Het
Olfr1259	T	C	2: 89,943,869	D82G	probably damaging	Het
Olfr1413	T	C	1: 92,573,330	I53T	possibly damaging	Het
Olfr370	T	A	8: 83,541,860	S239T	probably damaging	Het
Olfr895	C	A	9: 38,269,414	N292K	probably damaging	Het
Ovch2	T	A	7: 107,796,548	I88F	possibly damaging	Het
Palm3	A	G	8: 84,029,935	E692G	probably benign	Het
Pcsk6	T	C	7: 65,983,753	F578L	probably damaging	Het
Piezo2	A	C	18: 63,069,963	D1535E	probably damaging	Het
Ppp1r15b	T	C	1: 133,132,135	V130A	probably benign	Het
Proca1	T	C	11: 78,204,898	Y32H	probably damaging	Het
Prtg	T	A	9: 72,890,798	V682E	probably damaging	Het
Pyroxd1	A	T	6: 142,361,868	M455L	probably benign	Het
Rasa1	T	C	13: 85,226,635	D739G	possibly damaging	Het
Scn3a	T	C	2: 65,464,730	I1550V	possibly damaging	Het
Sepsecs	T	C	5: 52,643,871	D483G	probably benign	Het
Setd7	T	C	3: 51,550,355	D17G	probably damaging	Het
Sipa1l2	C	T	8: 125,491,245	C451Y	probably damaging	Het
Slc31a1	A	G	4: 62,388,702	Y165C	probably damaging	Het
Smg5	T	C	3: 88,342,469	F68L	possibly damaging	Het
Sptbn5	A	G	2: 120,077,208		probably benign	Het
Stk3	A	G	15: 35,114,565	I65T	probably damaging	Het
Tas2r115	C	T	6: 132,737,284	A235T	possibly damaging	Het
Tenm2	C	T	11: 36,049,097	A1400T	probably benign	Het
Tet1	T	A	10: 62,838,791	N1169Y	probably benign	Het
Treml2	T	A	17: 48,309,397		probably null	Het
Tspan11	A	G	6: 127,938,235	E104G	probably damaging	Het
Wdtc1	G	A	4: 133,296,431	A543V	probably damaging	Het
Zfp148	T	A	16: 33,496,819	D578E	probably damaging	Het
Zfp735	A	T	11: 73,711,855	N542Y	probably damaging	Het
Zfp735	A	T	11: 73,711,856	N542I	probably damaging	Het
Zfp869	T	A	8: 69,708,143	E65D	probably benign	Het

Other mutations in Ipo13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Ipo13	APN	4	117903405	missense	probably benign	0.10
IGL00800:Ipo13	APN	4	117912308	missense	probably benign	0.31
IGL00971:Ipo13	APN	4	117914367	missense	possibly damaging	0.83
IGL01552:Ipo13	APN	4	117900964	missense	probably benign	0.16
IGL01957:Ipo13	APN	4	117903881	missense	probably damaging	0.99
IGL02262:Ipo13	APN	4	117903813	missense	probably damaging	1.00
R0109:Ipo13	UTSW	4	117905016	missense	possibly damaging	0.92
R0142:Ipo13	UTSW	4	117905569	missense	probably damaging	1.00
R0771:Ipo13	UTSW	4	117894646	missense	possibly damaging	0.78
R1248:Ipo13	UTSW	4	117901031	missense	probably damaging	1.00
R1381:Ipo13	UTSW	4	117904395	missense	probably damaging	1.00
R1497:Ipo13	UTSW	4	117904659	missense	probably benign	0.04
R1614:Ipo13	UTSW	4	117904618	missense	probably benign	0.00
R1711:Ipo13	UTSW	4	117904522	missense	probably benign	0.38
R2037:Ipo13	UTSW	4	117904661	nonsense	probably null
R2200:Ipo13	UTSW	4	117904903	critical splice donor site	probably null
R3698:Ipo13	UTSW	4	117900693	missense	probably damaging	1.00
R3949:Ipo13	UTSW	4	117901042	missense	probably benign	0.10
R4894:Ipo13	UTSW	4	117903441	missense	probably damaging	0.99
R4894:Ipo13	UTSW	4	117904490	missense	possibly damaging	0.84
R4956:Ipo13	UTSW	4	117901571	missense	probably benign	0.00
R5679:Ipo13	UTSW	4	117894832	missense	probably damaging	1.00
R5879:Ipo13	UTSW	4	117903203	missense	possibly damaging	0.67
R5921:Ipo13	UTSW	4	117912089	missense	probably benign	0.14
R6250:Ipo13	UTSW	4	117912154	missense	possibly damaging	0.93
R6875:Ipo13	UTSW	4	117904911	missense	possibly damaging	0.90
R7178:Ipo13	UTSW	4	117903884	missense	possibly damaging	0.83
R7412:Ipo13	UTSW	4	117894871	missense	probably benign
R7687:Ipo13	UTSW	4	117911891	missense	probably benign	0.01
R7774:Ipo13	UTSW	4	117914297	missense	probably benign	0.11
R8390:Ipo13	UTSW	4	117912337	missense	probably damaging	0.99
R8489:Ipo13	UTSW	4	117901022	missense	probably damaging	0.98
R8525:Ipo13	UTSW	4	117904929	missense	probably damaging	0.99
R9039:Ipo13	UTSW	4	117900988	missense	probably damaging	0.98
R9229:Ipo13	UTSW	4	117901604	missense	probably damaging	0.96
R9319:Ipo13	UTSW	4	117912388	missense	probably benign	0.00
Z1088:Ipo13	UTSW	4	117904680	missense	probably benign	0.14
Z1176:Ipo13	UTSW	4	117904630	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ACTTCTGTGATACTGGAGCAG -3'
(R):5'- ACATCATCTCTTGCCCCAGG -3'

Sequencing Primer
(F):5'- ATACTGGAGCAGTGGTGGTC -3'
(R):5'- AGGTCCCAAATCCTCAGTGTG -3'

Posted On

2015-10-21