Mutagenetix > Incidental Mutations

Incidental Mutation 'R4687:Kdr'

353745

Institutional Source

Beutler Lab

Gene Symbol

Kdr

Ensembl Gene

ENSMUSG00000062960

Gene Name

kinase insert domain protein receptor

Synonyms

Flk1, vascular endothelial growth factor receptor- 2, VEGF receptor-2, VEGFR2, VEGFR-2, Flk-1

MMRRC Submission

041938-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4687 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

75932827-75978458 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 75968792 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 145 (N145S)

Ref Sequence

ENSEMBL: ENSMUSP00000109144 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113516]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000113516
AA Change: N145S

PolyPhen 2 Score 0.808 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000109144
Gene: ENSMUSG00000062960
AA Change: N145S

Domain	Start	End	E-Value	Type
IG	38	121	2.43e-2	SMART
IG_like	137	220	5.91e1	SMART
IG	233	327	2.64e-12	SMART
IG	339	420	1.2e-6	SMART
IG	432	546	2.14e0	SMART
IG	554	657	2.79e-2	SMART
IGc2	677	742	8.42e-20	SMART
TyrKc	832	1158	7.07e-138	SMART
low complexity region	1310	1315	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149573

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202473

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vascular endothelial growth factor (VEGF) is a major growth factor for endothelial cells. This gene encodes one of the two receptors of the VEGF. This receptor, known as kinase insert domain receptor, is a type III receptor tyrosine kinase. It functions as the main mediator of VEGF-induced endothelial proliferation, survival, migration, tubular morphogenesis and sprouting. The signalling and trafficking of this receptor are regulated by multiple factors, including Rab GTPase, P2Y purine nucleotide receptor, integrin alphaVbeta3, T-cell protein tyrosine phosphatase, etc.. Mutations of this gene are implicated in infantile capillary hemangiomas. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygous mice die at early embryonic stages due to failure of blood vessel formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700010I14Rik	T	A	17: 8,992,153	Y45N	probably damaging	Het
Agbl3	T	C	6: 34,798,326	V189A	probably damaging	Het
Akip1	C	A	7: 109,704,986	S90*	probably null	Het
Amn	A	T	12: 111,276,068	D439V	probably benign	Het
Arhgap17	T	A	7: 123,321,603	D149V	probably damaging	Het
Atp6v0a4	A	T	6: 38,092,465	I76N	possibly damaging	Het
Atp6v1h	A	T	1: 5,133,085	N291I	probably damaging	Het
Baiap2l2	G	T	15: 79,259,253	P462T	probably damaging	Het
Bves	C	T	10: 45,354,840		probably null	Het
Cabp7	T	A	11: 4,739,265	K127*	probably null	Het
Cacna1h	A	G	17: 25,393,910	V313A	possibly damaging	Het
Camkk2	T	C	5: 122,753,724	H245R	probably damaging	Het
Celsr1	T	A	15: 85,932,460	S1761C	possibly damaging	Het
Cfap46	T	C	7: 139,627,456	E1849G	possibly damaging	Het
Ciz1	T	C	2: 32,367,465	L174P	probably damaging	Het
Crim1	G	T	17: 78,303,025	C303F	probably damaging	Het
Cyp26c1	A	G	19: 37,692,937	Q396R	probably damaging	Het
Dnajc7	G	A	11: 100,599,300	P43L	probably damaging	Het
Dpf2	T	C	19: 5,907,012	H16R	probably damaging	Het
Dsp	A	G	13: 38,191,619	T1127A	probably damaging	Het
Dst	T	C	1: 34,201,123	L1525P	probably damaging	Het
Ehf	T	A	2: 103,267,126	D192V	probably damaging	Het
Frem1	G	T	4: 83,020,631	N71K	probably damaging	Het
Furin	T	A	7: 80,393,447	T339S	probably benign	Het
Gad1	T	A	2: 70,600,720	I569N	possibly damaging	Het
Gfi1	T	C	5: 107,723,810	K10R	probably damaging	Het
Gm20775	T	A	Y: 10,641,258		noncoding transcript	Homo
Gpn3	A	C	5: 122,378,575	D89A	possibly damaging	Het
Gpr18	T	A	14: 121,911,678	R312*	probably null	Het
Gsap	T	C	5: 21,246,971		probably benign	Het
H2-Ab1	C	A	17: 34,264,809	T48K	probably damaging	Het
Hmcn2	A	T	2: 31,438,285	N4326I	probably benign	Het
Igkv4-51	A	C	6: 69,681,730		probably benign	Het
Insr	T	C	8: 3,161,709	H1104R	probably benign	Het
Ipo13	A	T	4: 117,901,576	N697K	probably benign	Het
Iqcm	T	G	8: 75,762,989	F362V	probably damaging	Het
Irak4	T	C	15: 94,566,823	S425P	probably damaging	Het
Jakmip2	T	C	18: 43,577,412	E242G	possibly damaging	Het
Kdm4a	T	C	4: 118,144,083	K829R	probably damaging	Het
Klra9	A	T	6: 130,185,517	D185E	probably benign	Het
Lcn12	T	C	2: 25,493,321	N15S	probably benign	Het
Mei4	T	A	9: 81,927,317	M151K	probably damaging	Het
Mmp3	T	A	9: 7,451,223	S320T	probably benign	Het
Mrps5	C	G	2: 127,590,770	A37G	probably benign	Het
Mttp	A	G	3: 138,092,735	I800T	possibly damaging	Het
Nags	A	T	11: 102,148,196	Q451L	probably damaging	Het
Nbea	T	C	3: 56,058,065	T476A	probably damaging	Het
Ndufb10	T	C	17: 24,722,419	E145G	possibly damaging	Het
Neb	T	G	2: 52,304,035	S660R	possibly damaging	Het
Nppb	A	G	4: 147,986,296	K43E	probably benign	Het
Nup188	A	T	2: 30,330,633	Q906L	probably benign	Het
Olfr1259	T	C	2: 89,943,869	D82G	probably damaging	Het
Olfr1413	T	C	1: 92,573,330	I53T	possibly damaging	Het
Olfr370	T	A	8: 83,541,860	S239T	probably damaging	Het
Olfr895	C	A	9: 38,269,414	N292K	probably damaging	Het
Ovch2	T	A	7: 107,796,548	I88F	possibly damaging	Het
Palm3	A	G	8: 84,029,935	E692G	probably benign	Het
Pcsk6	T	C	7: 65,983,753	F578L	probably damaging	Het
Piezo2	A	C	18: 63,069,963	D1535E	probably damaging	Het
Ppp1r15b	T	C	1: 133,132,135	V130A	probably benign	Het
Proca1	T	C	11: 78,204,898	Y32H	probably damaging	Het
Prtg	T	A	9: 72,890,798	V682E	probably damaging	Het
Pyroxd1	A	T	6: 142,361,868	M455L	probably benign	Het
Rasa1	T	C	13: 85,226,635	D739G	possibly damaging	Het
Scn3a	T	C	2: 65,464,730	I1550V	possibly damaging	Het
Sepsecs	T	C	5: 52,643,871	D483G	probably benign	Het
Setd7	T	C	3: 51,550,355	D17G	probably damaging	Het
Sipa1l2	C	T	8: 125,491,245	C451Y	probably damaging	Het
Slc31a1	A	G	4: 62,388,702	Y165C	probably damaging	Het
Smg5	T	C	3: 88,342,469	F68L	possibly damaging	Het
Sptbn5	A	G	2: 120,077,208		probably benign	Het
Stk3	A	G	15: 35,114,565	I65T	probably damaging	Het
Tas2r115	C	T	6: 132,737,284	A235T	possibly damaging	Het
Tenm2	C	T	11: 36,049,097	A1400T	probably benign	Het
Tet1	T	A	10: 62,838,791	N1169Y	probably benign	Het
Treml2	T	A	17: 48,309,397		probably null	Het
Tspan11	A	G	6: 127,938,235	E104G	probably damaging	Het
Wdtc1	G	A	4: 133,296,431	A543V	probably damaging	Het
Zfp148	T	A	16: 33,496,819	D578E	probably damaging	Het
Zfp735	A	T	11: 73,711,855	N542Y	probably damaging	Het
Zfp735	A	T	11: 73,711,856	N542I	probably damaging	Het
Zfp869	T	A	8: 69,708,143	E65D	probably benign	Het

Other mutations in Kdr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00435:Kdr	APN	5	75968750	missense	probably damaging	1.00
IGL01094:Kdr	APN	5	75961760	missense	probably benign	0.00
IGL01310:Kdr	APN	5	75949601	missense	probably damaging	1.00
IGL01689:Kdr	APN	5	75936840	missense	probably benign	0.01
IGL01986:Kdr	APN	5	75952859	missense	probably benign	0.18
IGL02065:Kdr	APN	5	75961853	splice site	probably benign
IGL02200:Kdr	APN	5	75950102	splice site	probably benign
IGL02272:Kdr	APN	5	75961840	missense	probably benign
IGL02426:Kdr	APN	5	75974466	missense	probably benign	0.00
IGL02483:Kdr	APN	5	75936294	critical splice donor site	probably null
IGL02543:Kdr	APN	5	75964947	splice site	probably benign
IGL02590:Kdr	APN	5	75936323	missense	probably benign	0.00
IGL03204:Kdr	APN	5	75972382	missense	possibly damaging	0.96
IGL03228:Kdr	APN	5	75957048	missense	probably damaging	0.97
IGL03265:Kdr	APN	5	75960773	missense	probably damaging	1.00
engelein	UTSW	5	75952889	missense	probably damaging	1.00
PIT4131001:Kdr	UTSW	5	75941971	splice site	probably benign
PIT4519001:Kdr	UTSW	5	75936896	missense	possibly damaging	0.86
R0133:Kdr	UTSW	5	75951838	missense	probably damaging	1.00
R0197:Kdr	UTSW	5	75968422	missense	possibly damaging	0.82
R0282:Kdr	UTSW	5	75950100	splice site	probably benign
R0309:Kdr	UTSW	5	75946927	splice site	probably benign
R0371:Kdr	UTSW	5	75941834	missense	probably benign	0.22
R0396:Kdr	UTSW	5	75960728	missense	possibly damaging	0.65
R0498:Kdr	UTSW	5	75959138	missense	probably benign	0.00
R0932:Kdr	UTSW	5	75968805	missense	probably benign	0.02
R1077:Kdr	UTSW	5	75956231	missense	probably damaging	1.00
R1183:Kdr	UTSW	5	75946851	missense	probably damaging	1.00
R1713:Kdr	UTSW	5	75968467	missense	probably benign	0.03
R1853:Kdr	UTSW	5	75952905	missense	possibly damaging	0.67
R1854:Kdr	UTSW	5	75952905	missense	possibly damaging	0.67
R2142:Kdr	UTSW	5	75968423	missense	possibly damaging	0.56
R2238:Kdr	UTSW	5	75949519	missense	possibly damaging	0.78
R2891:Kdr	UTSW	5	75946836	missense	probably damaging	1.00
R2893:Kdr	UTSW	5	75946836	missense	probably damaging	1.00
R2894:Kdr	UTSW	5	75946836	missense	probably damaging	1.00
R2903:Kdr	UTSW	5	75966409	missense	probably damaging	1.00
R2904:Kdr	UTSW	5	75966409	missense	probably damaging	1.00
R3155:Kdr	UTSW	5	75968405	missense	probably benign	0.02
R3939:Kdr	UTSW	5	75972429	nonsense	probably null
R4051:Kdr	UTSW	5	75968408	missense	probably benign
R4151:Kdr	UTSW	5	75957101	missense	possibly damaging	0.94
R4433:Kdr	UTSW	5	75943925	missense	possibly damaging	0.61
R4691:Kdr	UTSW	5	75944599	missense	possibly damaging	0.79
R5185:Kdr	UTSW	5	75952417	splice site	probably null
R5544:Kdr	UTSW	5	75960743	nonsense	probably null
R6083:Kdr	UTSW	5	75944366	missense	probably damaging	1.00
R6477:Kdr	UTSW	5	75968841	missense	probably benign	0.02
R6568:Kdr	UTSW	5	75961774	missense	probably benign	0.01
R6647:Kdr	UTSW	5	75952889	missense	probably damaging	1.00
R6827:Kdr	UTSW	5	75944545	missense	probably damaging	1.00
R6887:Kdr	UTSW	5	75968451	missense	probably benign	0.00
R6929:Kdr	UTSW	5	75978104	missense	probably benign	0.16
R6993:Kdr	UTSW	5	75972411	missense	probably benign
R7022:Kdr	UTSW	5	75972260	nonsense	probably null
R7050:Kdr	UTSW	5	75950120	missense	probably damaging	1.00
R7099:Kdr	UTSW	5	75944333	missense	probably damaging	0.98
R7274:Kdr	UTSW	5	75964700	missense	probably benign	0.00
R7310:Kdr	UTSW	5	75944325	missense	probably damaging	0.99
R7565:Kdr	UTSW	5	75948843	missense	probably damaging	0.97
X0024:Kdr	UTSW	5	75974406	missense	probably damaging	1.00
Z1177:Kdr	UTSW	5	75968475	missense	probably benign	0.35

Predicted Primers

PCR Primer
(F):5'- AATGTGCTGTTGACCCTCCC -3'
(R):5'- CAGACTAGCCTGTGGATGTC -3'

Sequencing Primer
(F):5'- CCTATGGGAGCTTTGTAATTCAC -3'
(R):5'- TCATGCAAGTTGTCAATGATAGCC -3'

Posted On

2015-10-21