Incidental Mutation 'R4687:Gfi1'
ID353746
Institutional Source Beutler Lab
Gene Symbol Gfi1
Ensembl Gene ENSMUSG00000029275
Gene Namegrowth factor independent 1
SynonymsPal-1, Gfi-1, Pal1
MMRRC Submission 041938-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4687 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location107716657-107726036 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107723810 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 10 (K10R)
Ref Sequence ENSEMBL: ENSMUSP00000135880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031205] [ENSMUST00000065478] [ENSMUST00000159164] [ENSMUST00000159263]
Predicted Effect probably damaging
Transcript: ENSMUST00000031205
AA Change: K10R

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135884
Gene: ENSMUSG00000029275
AA Change: K10R

DomainStartEndE-ValueType
low complexity region 174 181 N/A INTRINSIC
low complexity region 184 202 N/A INTRINSIC
ZnF_C2H2 256 279 8.47e-4 SMART
ZnF_C2H2 285 307 1.82e-3 SMART
ZnF_C2H2 313 335 3.16e-3 SMART
ZnF_C2H2 341 363 3.89e-3 SMART
ZnF_C2HC 342 358 5.37e0 SMART
ZnF_C2H2 369 391 1.47e-3 SMART
ZnF_C2H2 397 420 1.36e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000065478
AA Change: K76R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135039
Gene: ENSMUSG00000029275
AA Change: K76R

DomainStartEndE-ValueType
low complexity region 6 24 N/A INTRINSIC
low complexity region 240 247 N/A INTRINSIC
low complexity region 250 268 N/A INTRINSIC
ZnF_C2H2 322 345 8.47e-4 SMART
ZnF_C2H2 351 373 1.82e-3 SMART
ZnF_C2H2 379 401 3.16e-3 SMART
ZnF_C2H2 407 429 3.89e-3 SMART
ZnF_C2HC 408 424 5.37e0 SMART
ZnF_C2H2 435 457 1.47e-3 SMART
ZnF_C2H2 463 486 1.36e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000159164
AA Change: K10R

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000137229
Gene: ENSMUSG00000029275
AA Change: K10R

DomainStartEndE-ValueType
low complexity region 174 181 N/A INTRINSIC
low complexity region 184 202 N/A INTRINSIC
ZnF_C2H2 256 279 8.47e-4 SMART
ZnF_C2H2 285 307 1.82e-3 SMART
ZnF_C2H2 313 335 3.16e-3 SMART
ZnF_C2H2 341 363 3.89e-3 SMART
ZnF_C2HC 342 358 5.37e0 SMART
ZnF_C2H2 369 391 1.47e-3 SMART
ZnF_C2H2 397 420 1.36e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000159263
AA Change: K10R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135880
Gene: ENSMUSG00000029275
AA Change: K10R

DomainStartEndE-ValueType
low complexity region 174 181 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161480
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162148
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear zinc finger protein that functions as a transcriptional repressor. This protein plays a role in diverse developmental contexts, including hematopoiesis and oncogenesis. It functions as part of a complex along with other cofactors to control histone modifications that lead to silencing of the target gene promoters. Mutations in this gene cause autosomal dominant severe congenital neutropenia, and also dominant nonimmune chronic idiopathic neutropenia of adults, which are heterogeneous hematopoietic disorders that cause predispositions to leukemias and infections. Multiple alternatively spliced variants, encoding the same protein, have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit loss of inner ear hair cells, ataxia, circling, and deafness. Mutants also show a block in granulocyte and neutrophil maturation, and are hypersensitive to endotoxin stimulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T A 17: 8,992,153 Y45N probably damaging Het
Agbl3 T C 6: 34,798,326 V189A probably damaging Het
Akip1 C A 7: 109,704,986 S90* probably null Het
Amn A T 12: 111,276,068 D439V probably benign Het
Arhgap17 T A 7: 123,321,603 D149V probably damaging Het
Atp6v0a4 A T 6: 38,092,465 I76N possibly damaging Het
Atp6v1h A T 1: 5,133,085 N291I probably damaging Het
Baiap2l2 G T 15: 79,259,253 P462T probably damaging Het
Bves C T 10: 45,354,840 probably null Het
Cabp7 T A 11: 4,739,265 K127* probably null Het
Cacna1h A G 17: 25,393,910 V313A possibly damaging Het
Camkk2 T C 5: 122,753,724 H245R probably damaging Het
Celsr1 T A 15: 85,932,460 S1761C possibly damaging Het
Cfap46 T C 7: 139,627,456 E1849G possibly damaging Het
Ciz1 T C 2: 32,367,465 L174P probably damaging Het
Crim1 G T 17: 78,303,025 C303F probably damaging Het
Cyp26c1 A G 19: 37,692,937 Q396R probably damaging Het
Dnajc7 G A 11: 100,599,300 P43L probably damaging Het
Dpf2 T C 19: 5,907,012 H16R probably damaging Het
Dsp A G 13: 38,191,619 T1127A probably damaging Het
Dst T C 1: 34,201,123 L1525P probably damaging Het
Ehf T A 2: 103,267,126 D192V probably damaging Het
Frem1 G T 4: 83,020,631 N71K probably damaging Het
Furin T A 7: 80,393,447 T339S probably benign Het
Gad1 T A 2: 70,600,720 I569N possibly damaging Het
Gm20775 T A Y: 10,641,258 noncoding transcript Homo
Gpn3 A C 5: 122,378,575 D89A possibly damaging Het
Gpr18 T A 14: 121,911,678 R312* probably null Het
Gsap T C 5: 21,246,971 probably benign Het
H2-Ab1 C A 17: 34,264,809 T48K probably damaging Het
Hmcn2 A T 2: 31,438,285 N4326I probably benign Het
Igkv4-51 A C 6: 69,681,730 probably benign Het
Insr T C 8: 3,161,709 H1104R probably benign Het
Ipo13 A T 4: 117,901,576 N697K probably benign Het
Iqcm T G 8: 75,762,989 F362V probably damaging Het
Irak4 T C 15: 94,566,823 S425P probably damaging Het
Jakmip2 T C 18: 43,577,412 E242G possibly damaging Het
Kdm4a T C 4: 118,144,083 K829R probably damaging Het
Kdr T C 5: 75,968,792 N145S possibly damaging Het
Klra9 A T 6: 130,185,517 D185E probably benign Het
Lcn12 T C 2: 25,493,321 N15S probably benign Het
Mei4 T A 9: 81,927,317 M151K probably damaging Het
Mmp3 T A 9: 7,451,223 S320T probably benign Het
Mrps5 C G 2: 127,590,770 A37G probably benign Het
Mttp A G 3: 138,092,735 I800T possibly damaging Het
Nags A T 11: 102,148,196 Q451L probably damaging Het
Nbea T C 3: 56,058,065 T476A probably damaging Het
Ndufb10 T C 17: 24,722,419 E145G possibly damaging Het
Neb T G 2: 52,304,035 S660R possibly damaging Het
Nppb A G 4: 147,986,296 K43E probably benign Het
Nup188 A T 2: 30,330,633 Q906L probably benign Het
Olfr1259 T C 2: 89,943,869 D82G probably damaging Het
Olfr1413 T C 1: 92,573,330 I53T possibly damaging Het
Olfr370 T A 8: 83,541,860 S239T probably damaging Het
Olfr895 C A 9: 38,269,414 N292K probably damaging Het
Ovch2 T A 7: 107,796,548 I88F possibly damaging Het
Palm3 A G 8: 84,029,935 E692G probably benign Het
Pcsk6 T C 7: 65,983,753 F578L probably damaging Het
Piezo2 A C 18: 63,069,963 D1535E probably damaging Het
Ppp1r15b T C 1: 133,132,135 V130A probably benign Het
Proca1 T C 11: 78,204,898 Y32H probably damaging Het
Prtg T A 9: 72,890,798 V682E probably damaging Het
Pyroxd1 A T 6: 142,361,868 M455L probably benign Het
Rasa1 T C 13: 85,226,635 D739G possibly damaging Het
Scn3a T C 2: 65,464,730 I1550V possibly damaging Het
Sepsecs T C 5: 52,643,871 D483G probably benign Het
Setd7 T C 3: 51,550,355 D17G probably damaging Het
Sipa1l2 C T 8: 125,491,245 C451Y probably damaging Het
Slc31a1 A G 4: 62,388,702 Y165C probably damaging Het
Smg5 T C 3: 88,342,469 F68L possibly damaging Het
Sptbn5 A G 2: 120,077,208 probably benign Het
Stk3 A G 15: 35,114,565 I65T probably damaging Het
Tas2r115 C T 6: 132,737,284 A235T possibly damaging Het
Tenm2 C T 11: 36,049,097 A1400T probably benign Het
Tet1 T A 10: 62,838,791 N1169Y probably benign Het
Treml2 T A 17: 48,309,397 probably null Het
Tspan11 A G 6: 127,938,235 E104G probably damaging Het
Wdtc1 G A 4: 133,296,431 A543V probably damaging Het
Zfp148 T A 16: 33,496,819 D578E probably damaging Het
Zfp735 A T 11: 73,711,855 N542Y probably damaging Het
Zfp735 A T 11: 73,711,856 N542I probably damaging Het
Zfp869 T A 8: 69,708,143 E65D probably benign Het
Other mutations in Gfi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02105:Gfi1 APN 5 107723722 splice site probably null
Pileup UTSW 5 107717768 missense probably damaging 1.00
Super8 UTSW 5 107720143 missense probably damaging 0.99
R1314:Gfi1 UTSW 5 107721874 splice site probably null
R2351:Gfi1 UTSW 5 107721774 missense probably damaging 1.00
R2680:Gfi1 UTSW 5 107721431 missense probably damaging 1.00
R4885:Gfi1 UTSW 5 107723286 missense probably damaging 1.00
R4951:Gfi1 UTSW 5 107720143 missense probably damaging 0.99
R5540:Gfi1 UTSW 5 107720125 missense probably damaging 0.99
R6193:Gfi1 UTSW 5 107721531 missense probably benign 0.45
R6782:Gfi1 UTSW 5 107725953 critical splice donor site probably null
R6993:Gfi1 UTSW 5 107717768 missense probably damaging 1.00
R7378:Gfi1 UTSW 5 107723229 missense possibly damaging 0.57
R7981:Gfi1 UTSW 5 107725677 intron probably benign
R8009:Gfi1 UTSW 5 107723801 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCTGAGCACCGGGAAAC -3'
(R):5'- TACCACTGAGCTGTTGCAGTG -3'

Sequencing Primer
(F):5'- AGGATAGCCTCCCCCGATTC -3'
(R):5'- ATTCGTGCCACCTGTCCGAG -3'
Posted On2015-10-21