Incidental Mutation 'R4687:Pcsk6'
ID353758
Institutional Source Beutler Lab
Gene Symbol Pcsk6
Ensembl Gene ENSMUSG00000030513
Gene Nameproprotein convertase subtilisin/kexin type 6
SynonymsPACE4, SPC4
MMRRC Submission 041938-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.391) question?
Stock #R4687 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location65861734-66050386 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65983753 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 578 (F578L)
Ref Sequence ENSEMBL: ENSMUSP00000095992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055576] [ENSMUST00000098391] [ENSMUST00000176209]
Predicted Effect probably damaging
Transcript: ENSMUST00000055576
AA Change: F578L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053742
Gene: ENSMUSG00000030513
AA Change: F578L

DomainStartEndE-ValueType
signal peptide 1 54 N/A INTRINSIC
Pfam:S8_pro-domain 65 141 3.1e-29 PFAM
Pfam:Peptidase_S8 186 469 5.2e-49 PFAM
Pfam:P_proprotein 529 619 9.7e-37 PFAM
FU 682 729 5.87e-11 SMART
EGF_like 688 737 5.03e1 SMART
FU 733 780 4.35e-14 SMART
EGF_like 738 771 3.57e1 SMART
FU 784 828 2.08e-11 SMART
EGF 789 819 2.48e1 SMART
FU 832 877 9.4e-10 SMART
EGF_like 837 868 6.28e1 SMART
FU 885 933 8.58e-4 SMART
EGF 890 920 1.69e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000098391
AA Change: F578L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095992
Gene: ENSMUSG00000030513
AA Change: F578L

DomainStartEndE-ValueType
signal peptide 1 54 N/A INTRINSIC
PDB:1KN6|A 62 129 2e-6 PDB
low complexity region 131 144 N/A INTRINSIC
Pfam:Peptidase_S8 190 478 1.1e-58 PFAM
Pfam:P_proprotein 529 619 4.5e-37 PFAM
FU 669 716 3.87e-11 SMART
EGF_like 675 724 5.03e1 SMART
FU 720 767 4.35e-14 SMART
EGF_like 725 758 3.57e1 SMART
FU 771 815 2.08e-11 SMART
EGF 776 806 2.48e1 SMART
FU 819 864 9.4e-10 SMART
EGF_like 824 855 6.28e1 SMART
FU 872 920 8.58e-4 SMART
EGF 877 907 1.69e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000176209
AA Change: F417L

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000135033
Gene: ENSMUSG00000030513
AA Change: F417L

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
Pfam:Peptidase_S8 103 372 6.5e-50 PFAM
Pfam:P_proprotein 368 458 6.2e-37 PFAM
FU 521 568 5.87e-11 SMART
EGF_like 527 576 5.03e1 SMART
FU 572 619 4.35e-14 SMART
EGF_like 577 610 3.57e1 SMART
FU 623 667 2.08e-11 SMART
EGF 628 658 2.48e1 SMART
FU 671 716 9.4e-10 SMART
EGF_like 676 707 6.28e1 SMART
FU 724 772 8.58e-4 SMART
EGF 729 759 1.69e1 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. The encoded protein undergoes an initial autocatalytic processing event in the ER to generate a heterodimer which exits the ER and sorts to the trans-Golgi network where a second autocatalytic event takes place and the catalytic activity is acquired. The encoded protease is constitutively secreted into the extracellular matrix and expressed in many tissues, including neuroendocrine, liver, gut, and brain. This gene encodes one of the seven basic amino acid-specific members which cleave their substrates at single or paired basic residues. Some of its substrates include transforming growth factor beta related proteins, proalbumin, and von Willebrand factor. This gene is thought to play a role in tumor progression and left-right patterning. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutation of this gene results in partial lethality by E15.5. Embryos develop situs ambiguus with left pulmonary isomerism or craniofacial malformations including cyclopia, or both. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T A 17: 8,992,153 Y45N probably damaging Het
Agbl3 T C 6: 34,798,326 V189A probably damaging Het
Akip1 C A 7: 109,704,986 S90* probably null Het
Amn A T 12: 111,276,068 D439V probably benign Het
Arhgap17 T A 7: 123,321,603 D149V probably damaging Het
Atp6v0a4 A T 6: 38,092,465 I76N possibly damaging Het
Atp6v1h A T 1: 5,133,085 N291I probably damaging Het
Baiap2l2 G T 15: 79,259,253 P462T probably damaging Het
Bves C T 10: 45,354,840 probably null Het
Cabp7 T A 11: 4,739,265 K127* probably null Het
Cacna1h A G 17: 25,393,910 V313A possibly damaging Het
Camkk2 T C 5: 122,753,724 H245R probably damaging Het
Celsr1 T A 15: 85,932,460 S1761C possibly damaging Het
Cfap46 T C 7: 139,627,456 E1849G possibly damaging Het
Ciz1 T C 2: 32,367,465 L174P probably damaging Het
Crim1 G T 17: 78,303,025 C303F probably damaging Het
Cyp26c1 A G 19: 37,692,937 Q396R probably damaging Het
Dnajc7 G A 11: 100,599,300 P43L probably damaging Het
Dpf2 T C 19: 5,907,012 H16R probably damaging Het
Dsp A G 13: 38,191,619 T1127A probably damaging Het
Dst T C 1: 34,201,123 L1525P probably damaging Het
Ehf T A 2: 103,267,126 D192V probably damaging Het
Frem1 G T 4: 83,020,631 N71K probably damaging Het
Furin T A 7: 80,393,447 T339S probably benign Het
Gad1 T A 2: 70,600,720 I569N possibly damaging Het
Gfi1 T C 5: 107,723,810 K10R probably damaging Het
Gm20775 T A Y: 10,641,258 noncoding transcript Homo
Gpn3 A C 5: 122,378,575 D89A possibly damaging Het
Gpr18 T A 14: 121,911,678 R312* probably null Het
Gsap T C 5: 21,246,971 probably benign Het
H2-Ab1 C A 17: 34,264,809 T48K probably damaging Het
Hmcn2 A T 2: 31,438,285 N4326I probably benign Het
Igkv4-51 A C 6: 69,681,730 probably benign Het
Insr T C 8: 3,161,709 H1104R probably benign Het
Ipo13 A T 4: 117,901,576 N697K probably benign Het
Iqcm T G 8: 75,762,989 F362V probably damaging Het
Irak4 T C 15: 94,566,823 S425P probably damaging Het
Jakmip2 T C 18: 43,577,412 E242G possibly damaging Het
Kdm4a T C 4: 118,144,083 K829R probably damaging Het
Kdr T C 5: 75,968,792 N145S possibly damaging Het
Klra9 A T 6: 130,185,517 D185E probably benign Het
Lcn12 T C 2: 25,493,321 N15S probably benign Het
Mei4 T A 9: 81,927,317 M151K probably damaging Het
Mmp3 T A 9: 7,451,223 S320T probably benign Het
Mrps5 C G 2: 127,590,770 A37G probably benign Het
Mttp A G 3: 138,092,735 I800T possibly damaging Het
Nags A T 11: 102,148,196 Q451L probably damaging Het
Nbea T C 3: 56,058,065 T476A probably damaging Het
Ndufb10 T C 17: 24,722,419 E145G possibly damaging Het
Neb T G 2: 52,304,035 S660R possibly damaging Het
Nppb A G 4: 147,986,296 K43E probably benign Het
Nup188 A T 2: 30,330,633 Q906L probably benign Het
Olfr1259 T C 2: 89,943,869 D82G probably damaging Het
Olfr1413 T C 1: 92,573,330 I53T possibly damaging Het
Olfr370 T A 8: 83,541,860 S239T probably damaging Het
Olfr895 C A 9: 38,269,414 N292K probably damaging Het
Ovch2 T A 7: 107,796,548 I88F possibly damaging Het
Palm3 A G 8: 84,029,935 E692G probably benign Het
Piezo2 A C 18: 63,069,963 D1535E probably damaging Het
Ppp1r15b T C 1: 133,132,135 V130A probably benign Het
Proca1 T C 11: 78,204,898 Y32H probably damaging Het
Prtg T A 9: 72,890,798 V682E probably damaging Het
Pyroxd1 A T 6: 142,361,868 M455L probably benign Het
Rasa1 T C 13: 85,226,635 D739G possibly damaging Het
Scn3a T C 2: 65,464,730 I1550V possibly damaging Het
Sepsecs T C 5: 52,643,871 D483G probably benign Het
Setd7 T C 3: 51,550,355 D17G probably damaging Het
Sipa1l2 C T 8: 125,491,245 C451Y probably damaging Het
Slc31a1 A G 4: 62,388,702 Y165C probably damaging Het
Smg5 T C 3: 88,342,469 F68L possibly damaging Het
Sptbn5 A G 2: 120,077,208 probably benign Het
Stk3 A G 15: 35,114,565 I65T probably damaging Het
Tas2r115 C T 6: 132,737,284 A235T possibly damaging Het
Tenm2 C T 11: 36,049,097 A1400T probably benign Het
Tet1 T A 10: 62,838,791 N1169Y probably benign Het
Treml2 T A 17: 48,309,397 probably null Het
Tspan11 A G 6: 127,938,235 E104G probably damaging Het
Wdtc1 G A 4: 133,296,431 A543V probably damaging Het
Zfp148 T A 16: 33,496,819 D578E probably damaging Het
Zfp735 A T 11: 73,711,855 N542Y probably damaging Het
Zfp735 A T 11: 73,711,856 N542I probably damaging Het
Zfp869 T A 8: 69,708,143 E65D probably benign Het
Other mutations in Pcsk6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Pcsk6 APN 7 65927820 missense probably damaging 1.00
IGL01609:Pcsk6 APN 7 66035273 splice site probably null
IGL01986:Pcsk6 APN 7 65927877 missense probably damaging 1.00
IGL02592:Pcsk6 APN 7 65969028 missense probably damaging 1.00
IGL02720:Pcsk6 APN 7 65980247 nonsense probably null
R0045:Pcsk6 UTSW 7 65962928 missense probably damaging 1.00
R0045:Pcsk6 UTSW 7 65962928 missense probably damaging 1.00
R0053:Pcsk6 UTSW 7 65983703 splice site probably benign
R0053:Pcsk6 UTSW 7 65983703 splice site probably benign
R0103:Pcsk6 UTSW 7 65929097 splice site probably benign
R0103:Pcsk6 UTSW 7 65929097 splice site probably benign
R0119:Pcsk6 UTSW 7 66039043 missense probably benign 0.10
R0299:Pcsk6 UTSW 7 66039043 missense probably benign 0.10
R0415:Pcsk6 UTSW 7 66033874 missense probably damaging 1.00
R0496:Pcsk6 UTSW 7 65927249 missense probably benign 0.00
R0518:Pcsk6 UTSW 7 65980167 missense possibly damaging 0.64
R0748:Pcsk6 UTSW 7 66038968 unclassified probably benign
R1456:Pcsk6 UTSW 7 66043535 missense possibly damaging 0.87
R1613:Pcsk6 UTSW 7 65910311 splice site probably benign
R1680:Pcsk6 UTSW 7 66035250 missense probably benign 0.14
R1682:Pcsk6 UTSW 7 65910228 missense probably damaging 1.00
R1987:Pcsk6 UTSW 7 65927287 missense possibly damaging 0.60
R4191:Pcsk6 UTSW 7 66025308 missense probably damaging 0.98
R4193:Pcsk6 UTSW 7 66025308 missense probably damaging 0.98
R4577:Pcsk6 UTSW 7 65959266 nonsense probably null
R4592:Pcsk6 UTSW 7 65931732 missense possibly damaging 0.54
R4697:Pcsk6 UTSW 7 65959241 missense probably damaging 1.00
R4778:Pcsk6 UTSW 7 65959145 missense probably damaging 1.00
R5065:Pcsk6 UTSW 7 65910299 missense possibly damaging 0.84
R5218:Pcsk6 UTSW 7 66025288 missense probably benign 0.01
R5356:Pcsk6 UTSW 7 65970592 missense probably damaging 1.00
R5427:Pcsk6 UTSW 7 66033899 missense probably benign 0.01
R5589:Pcsk6 UTSW 7 65929185 critical splice donor site probably null
R5637:Pcsk6 UTSW 7 65968997 missense probably damaging 1.00
R5888:Pcsk6 UTSW 7 66043624 missense probably null
R5958:Pcsk6 UTSW 7 66043611 missense probably damaging 1.00
R5997:Pcsk6 UTSW 7 65959293 missense probably damaging 1.00
R6191:Pcsk6 UTSW 7 65929127 missense probably benign 0.19
R6274:Pcsk6 UTSW 7 66033844 missense probably damaging 1.00
R6374:Pcsk6 UTSW 7 65980155 missense possibly damaging 0.80
R6393:Pcsk6 UTSW 7 65969014 missense probably damaging 1.00
R6730:Pcsk6 UTSW 7 65980248 missense probably damaging 1.00
R7205:Pcsk6 UTSW 7 66025408 critical splice donor site probably null
R7493:Pcsk6 UTSW 7 66043566 missense possibly damaging 0.53
R7570:Pcsk6 UTSW 7 66033898 missense probably benign 0.03
R7731:Pcsk6 UTSW 7 66033893 missense probably benign 0.00
R7779:Pcsk6 UTSW 7 66025404 missense probably benign 0.03
R8042:Pcsk6 UTSW 7 65927935 missense possibly damaging 0.87
Z1177:Pcsk6 UTSW 7 65959113 missense probably damaging 1.00
Z1177:Pcsk6 UTSW 7 66033811 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACAGCAAGGCAGTCCTATGG -3'
(R):5'- TTACCAGCAGCACTCCCTTTAA -3'

Sequencing Primer
(F):5'- TTCCCTAGGGCCTACATGGTAGAAG -3'
(R):5'- GCACTCCCTTTAAATAAAGCCTTG -3'
Posted On2015-10-21