Incidental Mutation 'R4687:Furin'
ID353759
Institutional Source Beutler Lab
Gene Symbol Furin
Ensembl Gene ENSMUSG00000030530
Gene Namefurin (paired basic amino acid cleaving enzyme)
SynonymsPcsk3, PACE, SPC1, 9130404I01Rik, Fur
MMRRC Submission 041938-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4687 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location80388585-80405436 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 80393447 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 339 (T339S)
Ref Sequence ENSEMBL: ENSMUSP00000113370 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107362] [ENSMUST00000120753] [ENSMUST00000122232]
Predicted Effect probably benign
Transcript: ENSMUST00000107362
AA Change: T339S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000102985
Gene: ENSMUSG00000030530
AA Change: T339S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
PDB:1KN6|A 27 107 4e-7 PDB
Pfam:Peptidase_S8 148 436 3.2e-62 PFAM
Pfam:P_proprotein 484 570 1.3e-33 PFAM
FU 577 620 4.67e-5 SMART
FU 638 681 2.13e-8 SMART
transmembrane domain 713 735 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120753
AA Change: T339S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000113793
Gene: ENSMUSG00000030530
AA Change: T339S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:S8_pro-domain 33 107 5.8e-28 PFAM
Pfam:Peptidase_S8 144 427 9.1e-51 PFAM
Pfam:P_proprotein 484 570 4.4e-32 PFAM
FU 577 620 4.67e-5 SMART
FU 638 681 2.13e-8 SMART
transmembrane domain 713 735 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122232
AA Change: T339S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000113370
Gene: ENSMUSG00000030530
AA Change: T339S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
PDB:1KN6|A 27 107 4e-7 PDB
Pfam:Peptidase_S8 148 436 3.2e-62 PFAM
Pfam:P_proprotein 484 570 1.3e-33 PFAM
FU 577 620 4.67e-5 SMART
FU 638 681 2.13e-8 SMART
transmembrane domain 713 735 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146771
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153446
Predicted Effect probably benign
Transcript: ENSMUST00000206352
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a calcium-dependent serine endoprotease that proteolytically activates different proprotein substrates traversing the secretory pathway. The encoded protein undergoes proteolytic autoactivation during which an N-terminal propeptide is cleaved to generate the mature protein. Mice lacking the encoded protein die at an embryonic stage and display hemodynamic insufficiency, cardiac ventral closure defect, axial rotation defect and abnormal yolk sac vasculature. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]
PHENOTYPE: Homozygous null embryos die at E10.5-E11.5. Embryos homozygous for one knock-out allele show multiple tissue abnormalities including abnormal yolk sac vasculature and chorioallantoic fusion, failure of axial rotation, a kinked neural tube, exencephaly and severe ventral closure and cardiac defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T A 17: 8,992,153 Y45N probably damaging Het
Agbl3 T C 6: 34,798,326 V189A probably damaging Het
Akip1 C A 7: 109,704,986 S90* probably null Het
Amn A T 12: 111,276,068 D439V probably benign Het
Arhgap17 T A 7: 123,321,603 D149V probably damaging Het
Atp6v0a4 A T 6: 38,092,465 I76N possibly damaging Het
Atp6v1h A T 1: 5,133,085 N291I probably damaging Het
Baiap2l2 G T 15: 79,259,253 P462T probably damaging Het
Bves C T 10: 45,354,840 probably null Het
Cabp7 T A 11: 4,739,265 K127* probably null Het
Cacna1h A G 17: 25,393,910 V313A possibly damaging Het
Camkk2 T C 5: 122,753,724 H245R probably damaging Het
Celsr1 T A 15: 85,932,460 S1761C possibly damaging Het
Cfap46 T C 7: 139,627,456 E1849G possibly damaging Het
Ciz1 T C 2: 32,367,465 L174P probably damaging Het
Crim1 G T 17: 78,303,025 C303F probably damaging Het
Cyp26c1 A G 19: 37,692,937 Q396R probably damaging Het
Dnajc7 G A 11: 100,599,300 P43L probably damaging Het
Dpf2 T C 19: 5,907,012 H16R probably damaging Het
Dsp A G 13: 38,191,619 T1127A probably damaging Het
Dst T C 1: 34,201,123 L1525P probably damaging Het
Ehf T A 2: 103,267,126 D192V probably damaging Het
Frem1 G T 4: 83,020,631 N71K probably damaging Het
Gad1 T A 2: 70,600,720 I569N possibly damaging Het
Gfi1 T C 5: 107,723,810 K10R probably damaging Het
Gm20775 T A Y: 10,641,258 noncoding transcript Homo
Gpn3 A C 5: 122,378,575 D89A possibly damaging Het
Gpr18 T A 14: 121,911,678 R312* probably null Het
Gsap T C 5: 21,246,971 probably benign Het
H2-Ab1 C A 17: 34,264,809 T48K probably damaging Het
Hmcn2 A T 2: 31,438,285 N4326I probably benign Het
Igkv4-51 A C 6: 69,681,730 probably benign Het
Insr T C 8: 3,161,709 H1104R probably benign Het
Ipo13 A T 4: 117,901,576 N697K probably benign Het
Iqcm T G 8: 75,762,989 F362V probably damaging Het
Irak4 T C 15: 94,566,823 S425P probably damaging Het
Jakmip2 T C 18: 43,577,412 E242G possibly damaging Het
Kdm4a T C 4: 118,144,083 K829R probably damaging Het
Kdr T C 5: 75,968,792 N145S possibly damaging Het
Klra9 A T 6: 130,185,517 D185E probably benign Het
Lcn12 T C 2: 25,493,321 N15S probably benign Het
Mei4 T A 9: 81,927,317 M151K probably damaging Het
Mmp3 T A 9: 7,451,223 S320T probably benign Het
Mrps5 C G 2: 127,590,770 A37G probably benign Het
Mttp A G 3: 138,092,735 I800T possibly damaging Het
Nags A T 11: 102,148,196 Q451L probably damaging Het
Nbea T C 3: 56,058,065 T476A probably damaging Het
Ndufb10 T C 17: 24,722,419 E145G possibly damaging Het
Neb T G 2: 52,304,035 S660R possibly damaging Het
Nppb A G 4: 147,986,296 K43E probably benign Het
Nup188 A T 2: 30,330,633 Q906L probably benign Het
Olfr1259 T C 2: 89,943,869 D82G probably damaging Het
Olfr1413 T C 1: 92,573,330 I53T possibly damaging Het
Olfr370 T A 8: 83,541,860 S239T probably damaging Het
Olfr895 C A 9: 38,269,414 N292K probably damaging Het
Ovch2 T A 7: 107,796,548 I88F possibly damaging Het
Palm3 A G 8: 84,029,935 E692G probably benign Het
Pcsk6 T C 7: 65,983,753 F578L probably damaging Het
Piezo2 A C 18: 63,069,963 D1535E probably damaging Het
Ppp1r15b T C 1: 133,132,135 V130A probably benign Het
Proca1 T C 11: 78,204,898 Y32H probably damaging Het
Prtg T A 9: 72,890,798 V682E probably damaging Het
Pyroxd1 A T 6: 142,361,868 M455L probably benign Het
Rasa1 T C 13: 85,226,635 D739G possibly damaging Het
Scn3a T C 2: 65,464,730 I1550V possibly damaging Het
Sepsecs T C 5: 52,643,871 D483G probably benign Het
Setd7 T C 3: 51,550,355 D17G probably damaging Het
Sipa1l2 C T 8: 125,491,245 C451Y probably damaging Het
Slc31a1 A G 4: 62,388,702 Y165C probably damaging Het
Smg5 T C 3: 88,342,469 F68L possibly damaging Het
Sptbn5 A G 2: 120,077,208 probably benign Het
Stk3 A G 15: 35,114,565 I65T probably damaging Het
Tas2r115 C T 6: 132,737,284 A235T possibly damaging Het
Tenm2 C T 11: 36,049,097 A1400T probably benign Het
Tet1 T A 10: 62,838,791 N1169Y probably benign Het
Treml2 T A 17: 48,309,397 probably null Het
Tspan11 A G 6: 127,938,235 E104G probably damaging Het
Wdtc1 G A 4: 133,296,431 A543V probably damaging Het
Zfp148 T A 16: 33,496,819 D578E probably damaging Het
Zfp735 A T 11: 73,711,855 N542Y probably damaging Het
Zfp735 A T 11: 73,711,856 N542I probably damaging Het
Zfp869 T A 8: 69,708,143 E65D probably benign Het
Other mutations in Furin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00816:Furin APN 7 80392567 missense probably damaging 1.00
IGL00910:Furin APN 7 80390996 missense probably benign
IGL01701:Furin APN 7 80392492 missense probably benign 0.11
IGL01701:Furin APN 7 80390759 missense probably benign 0.00
IGL01921:Furin APN 7 80395954 unclassified probably benign
IGL01981:Furin APN 7 80392899 missense probably damaging 1.00
IGL02035:Furin APN 7 80390987 missense probably benign
IGL02096:Furin APN 7 80393459 missense probably damaging 1.00
IGL02508:Furin APN 7 80392521 missense probably benign 0.01
IGL02611:Furin APN 7 80391778 missense probably benign 0.04
R0359:Furin UTSW 7 80391284 missense probably damaging 1.00
R0481:Furin UTSW 7 80393549 missense probably damaging 1.00
R0554:Furin UTSW 7 80391284 missense probably damaging 1.00
R1346:Furin UTSW 7 80392184 unclassified probably benign
R1347:Furin UTSW 7 80392184 unclassified probably benign
R1373:Furin UTSW 7 80392184 unclassified probably benign
R1553:Furin UTSW 7 80398592 splice site probably null
R1693:Furin UTSW 7 80392482 missense probably damaging 1.00
R4524:Furin UTSW 7 80398634 splice site probably null
R4869:Furin UTSW 7 80396979 missense probably damaging 1.00
R5249:Furin UTSW 7 80393421 missense probably damaging 1.00
R5498:Furin UTSW 7 80391794 missense probably damaging 1.00
R5708:Furin UTSW 7 80397855 intron probably benign
R6086:Furin UTSW 7 80395431 missense probably damaging 1.00
R6505:Furin UTSW 7 80393617 missense probably damaging 1.00
R6772:Furin UTSW 7 80393492 missense probably damaging 1.00
R6945:Furin UTSW 7 80391090 missense possibly damaging 0.82
R6954:Furin UTSW 7 80396964 missense possibly damaging 0.79
R7396:Furin UTSW 7 80398114 missense probably benign 0.00
R7510:Furin UTSW 7 80393585 missense probably damaging 1.00
R7542:Furin UTSW 7 80393459 missense probably damaging 1.00
R7577:Furin UTSW 7 80396986 missense probably damaging 1.00
R7812:Furin UTSW 7 80395974 missense possibly damaging 0.94
R7995:Furin UTSW 7 80395447 missense probably damaging 1.00
R8351:Furin UTSW 7 80398722 missense probably benign 0.00
R8389:Furin UTSW 7 80390879 missense probably benign 0.00
R8451:Furin UTSW 7 80398722 missense probably benign 0.00
X0050:Furin UTSW 7 80395412 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGATGGTTTTGCAGCCCG -3'
(R):5'- TAGCCCACTTCGTTCACAGG -3'

Sequencing Primer
(F):5'- AAGGGTCTGGGGAATCTCC -3'
(R):5'- ACTTCGTTCACAGGGCCGAG -3'
Posted On2015-10-21