Incidental Mutation 'R4687:Furin'
ID 353759
Institutional Source Beutler Lab
Gene Symbol Furin
Ensembl Gene ENSMUSG00000030530
Gene Name furin, paired basic amino acid cleaving enzyme
Synonyms PACE, 9130404I01Rik, SPC1, Pcsk3, Fur
MMRRC Submission 041938-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4687 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 80038942-80055188 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 80043195 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 339 (T339S)
Ref Sequence ENSEMBL: ENSMUSP00000113370 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107362] [ENSMUST00000120753] [ENSMUST00000122232]
AlphaFold P23188
Predicted Effect probably benign
Transcript: ENSMUST00000107362
AA Change: T339S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000102985
Gene: ENSMUSG00000030530
AA Change: T339S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
PDB:1KN6|A 27 107 4e-7 PDB
Pfam:Peptidase_S8 148 436 3.2e-62 PFAM
Pfam:P_proprotein 484 570 1.3e-33 PFAM
FU 577 620 4.67e-5 SMART
FU 638 681 2.13e-8 SMART
transmembrane domain 713 735 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120753
AA Change: T339S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000113793
Gene: ENSMUSG00000030530
AA Change: T339S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:S8_pro-domain 33 107 5.8e-28 PFAM
Pfam:Peptidase_S8 144 427 9.1e-51 PFAM
Pfam:P_proprotein 484 570 4.4e-32 PFAM
FU 577 620 4.67e-5 SMART
FU 638 681 2.13e-8 SMART
transmembrane domain 713 735 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122232
AA Change: T339S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000113370
Gene: ENSMUSG00000030530
AA Change: T339S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
PDB:1KN6|A 27 107 4e-7 PDB
Pfam:Peptidase_S8 148 436 3.2e-62 PFAM
Pfam:P_proprotein 484 570 1.3e-33 PFAM
FU 577 620 4.67e-5 SMART
FU 638 681 2.13e-8 SMART
transmembrane domain 713 735 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146771
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153446
Predicted Effect probably benign
Transcript: ENSMUST00000206352
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a calcium-dependent serine endoprotease that proteolytically activates different proprotein substrates traversing the secretory pathway. The encoded protein undergoes proteolytic autoactivation during which an N-terminal propeptide is cleaved to generate the mature protein. Mice lacking the encoded protein die at an embryonic stage and display hemodynamic insufficiency, cardiac ventral closure defect, axial rotation defect and abnormal yolk sac vasculature. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]
PHENOTYPE: Homozygous null embryos die at E10.5-E11.5. Embryos homozygous for one knock-out allele show multiple tissue abnormalities including abnormal yolk sac vasculature and chorioallantoic fusion, failure of axial rotation, a kinked neural tube, exencephaly and severe ventral closure and cardiac defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T A 17: 9,210,985 (GRCm39) Y45N probably damaging Het
Agbl3 T C 6: 34,775,261 (GRCm39) V189A probably damaging Het
Akip1 C A 7: 109,304,193 (GRCm39) S90* probably null Het
Amn A T 12: 111,242,502 (GRCm39) D439V probably benign Het
Arhgap17 T A 7: 122,920,826 (GRCm39) D149V probably damaging Het
Atp6v0a4 A T 6: 38,069,400 (GRCm39) I76N possibly damaging Het
Atp6v1h A T 1: 5,203,308 (GRCm39) N291I probably damaging Het
Baiap2l2 G T 15: 79,143,453 (GRCm39) P462T probably damaging Het
Bves C T 10: 45,230,936 (GRCm39) probably null Het
Cabp7 T A 11: 4,689,265 (GRCm39) K127* probably null Het
Cacna1h A G 17: 25,612,884 (GRCm39) V313A possibly damaging Het
Camkk2 T C 5: 122,891,787 (GRCm39) H245R probably damaging Het
Celsr1 T A 15: 85,816,661 (GRCm39) S1761C possibly damaging Het
Cfap46 T C 7: 139,207,372 (GRCm39) E1849G possibly damaging Het
Ciz1 T C 2: 32,257,477 (GRCm39) L174P probably damaging Het
Crim1 G T 17: 78,610,454 (GRCm39) C303F probably damaging Het
Cyp26c1 A G 19: 37,681,385 (GRCm39) Q396R probably damaging Het
Dnajc7 G A 11: 100,490,126 (GRCm39) P43L probably damaging Het
Dpf2 T C 19: 5,957,040 (GRCm39) H16R probably damaging Het
Dsp A G 13: 38,375,595 (GRCm39) T1127A probably damaging Het
Dst T C 1: 34,240,204 (GRCm39) L1525P probably damaging Het
Ehf T A 2: 103,097,471 (GRCm39) D192V probably damaging Het
Frem1 G T 4: 82,938,868 (GRCm39) N71K probably damaging Het
Gad1 T A 2: 70,431,064 (GRCm39) I569N possibly damaging Het
Gfi1 T C 5: 107,871,676 (GRCm39) K10R probably damaging Het
Gm20775 T A Y: 10,641,258 (GRCm39) noncoding transcript Homo
Gpn3 A C 5: 122,516,638 (GRCm39) D89A possibly damaging Het
Gpr18 T A 14: 122,149,090 (GRCm39) R312* probably null Het
Gsap T C 5: 21,451,969 (GRCm39) probably benign Het
H2-Ab1 C A 17: 34,483,783 (GRCm39) T48K probably damaging Het
Hmcn2 A T 2: 31,328,297 (GRCm39) N4326I probably benign Het
Igkv4-51 A C 6: 69,658,714 (GRCm39) probably benign Het
Insr T C 8: 3,211,709 (GRCm39) H1104R probably benign Het
Ipo13 A T 4: 117,758,773 (GRCm39) N697K probably benign Het
Iqcm T G 8: 76,489,617 (GRCm39) F362V probably damaging Het
Irak4 T C 15: 94,464,704 (GRCm39) S425P probably damaging Het
Jakmip2 T C 18: 43,710,477 (GRCm39) E242G possibly damaging Het
Kdm4a T C 4: 118,001,280 (GRCm39) K829R probably damaging Het
Kdr T C 5: 76,129,452 (GRCm39) N145S possibly damaging Het
Klra9 A T 6: 130,162,480 (GRCm39) D185E probably benign Het
Lcn12 T C 2: 25,383,333 (GRCm39) N15S probably benign Het
Mei4 T A 9: 81,809,370 (GRCm39) M151K probably damaging Het
Mmp3 T A 9: 7,451,223 (GRCm39) S320T probably benign Het
Mrps5 C G 2: 127,432,690 (GRCm39) A37G probably benign Het
Mttp A G 3: 137,798,496 (GRCm39) I800T possibly damaging Het
Nags A T 11: 102,039,022 (GRCm39) Q451L probably damaging Het
Nbea T C 3: 55,965,486 (GRCm39) T476A probably damaging Het
Ndufb10 T C 17: 24,941,393 (GRCm39) E145G possibly damaging Het
Neb T G 2: 52,194,047 (GRCm39) S660R possibly damaging Het
Nppb A G 4: 148,070,753 (GRCm39) K43E probably benign Het
Nup188 A T 2: 30,220,645 (GRCm39) Q906L probably benign Het
Or10k2 T A 8: 84,268,489 (GRCm39) S239T probably damaging Het
Or4c12 T C 2: 89,774,213 (GRCm39) D82G probably damaging Het
Or8c17 C A 9: 38,180,710 (GRCm39) N292K probably damaging Het
Or9s23 T C 1: 92,501,052 (GRCm39) I53T possibly damaging Het
Ovch2 T A 7: 107,395,755 (GRCm39) I88F possibly damaging Het
Palm3 A G 8: 84,756,564 (GRCm39) E692G probably benign Het
Pcsk6 T C 7: 65,633,501 (GRCm39) F578L probably damaging Het
Piezo2 A C 18: 63,203,034 (GRCm39) D1535E probably damaging Het
Ppp1r15b T C 1: 133,059,873 (GRCm39) V130A probably benign Het
Proca1 T C 11: 78,095,724 (GRCm39) Y32H probably damaging Het
Prtg T A 9: 72,798,080 (GRCm39) V682E probably damaging Het
Pyroxd1 A T 6: 142,307,594 (GRCm39) M455L probably benign Het
Rasa1 T C 13: 85,374,754 (GRCm39) D739G possibly damaging Het
Scn3a T C 2: 65,295,074 (GRCm39) I1550V possibly damaging Het
Sepsecs T C 5: 52,801,213 (GRCm39) D483G probably benign Het
Setd7 T C 3: 51,457,776 (GRCm39) D17G probably damaging Het
Sipa1l2 C T 8: 126,217,984 (GRCm39) C451Y probably damaging Het
Slc31a1 A G 4: 62,306,939 (GRCm39) Y165C probably damaging Het
Smg5 T C 3: 88,249,776 (GRCm39) F68L possibly damaging Het
Sptbn5 A G 2: 119,907,689 (GRCm39) probably benign Het
Stk3 A G 15: 35,114,711 (GRCm39) I65T probably damaging Het
Tas2r115 C T 6: 132,714,247 (GRCm39) A235T possibly damaging Het
Tenm2 C T 11: 35,939,924 (GRCm39) A1400T probably benign Het
Tet1 T A 10: 62,674,570 (GRCm39) N1169Y probably benign Het
Treml2 T A 17: 48,616,425 (GRCm39) probably null Het
Tspan11 A G 6: 127,915,198 (GRCm39) E104G probably damaging Het
Wdtc1 G A 4: 133,023,742 (GRCm39) A543V probably damaging Het
Zfp148 T A 16: 33,317,189 (GRCm39) D578E probably damaging Het
Zfp735 A T 11: 73,602,682 (GRCm39) N542I probably damaging Het
Zfp735 A T 11: 73,602,681 (GRCm39) N542Y probably damaging Het
Zfp869 T A 8: 70,160,793 (GRCm39) E65D probably benign Het
Other mutations in Furin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00816:Furin APN 7 80,042,315 (GRCm39) missense probably damaging 1.00
IGL00910:Furin APN 7 80,040,744 (GRCm39) missense probably benign
IGL01701:Furin APN 7 80,040,507 (GRCm39) missense probably benign 0.00
IGL01701:Furin APN 7 80,042,240 (GRCm39) missense probably benign 0.11
IGL01921:Furin APN 7 80,045,702 (GRCm39) unclassified probably benign
IGL01981:Furin APN 7 80,042,647 (GRCm39) missense probably damaging 1.00
IGL02035:Furin APN 7 80,040,735 (GRCm39) missense probably benign
IGL02096:Furin APN 7 80,043,207 (GRCm39) missense probably damaging 1.00
IGL02508:Furin APN 7 80,042,269 (GRCm39) missense probably benign 0.01
IGL02611:Furin APN 7 80,041,526 (GRCm39) missense probably benign 0.04
R0359:Furin UTSW 7 80,041,032 (GRCm39) missense probably damaging 1.00
R0481:Furin UTSW 7 80,043,297 (GRCm39) missense probably damaging 1.00
R0554:Furin UTSW 7 80,041,032 (GRCm39) missense probably damaging 1.00
R1346:Furin UTSW 7 80,041,932 (GRCm39) unclassified probably benign
R1347:Furin UTSW 7 80,041,932 (GRCm39) unclassified probably benign
R1373:Furin UTSW 7 80,041,932 (GRCm39) unclassified probably benign
R1553:Furin UTSW 7 80,048,340 (GRCm39) splice site probably null
R1693:Furin UTSW 7 80,042,230 (GRCm39) missense probably damaging 1.00
R4524:Furin UTSW 7 80,048,382 (GRCm39) splice site probably null
R4869:Furin UTSW 7 80,046,727 (GRCm39) missense probably damaging 1.00
R5249:Furin UTSW 7 80,043,169 (GRCm39) missense probably damaging 1.00
R5498:Furin UTSW 7 80,041,542 (GRCm39) missense probably damaging 1.00
R5708:Furin UTSW 7 80,047,603 (GRCm39) intron probably benign
R6086:Furin UTSW 7 80,045,179 (GRCm39) missense probably damaging 1.00
R6505:Furin UTSW 7 80,043,365 (GRCm39) missense probably damaging 1.00
R6772:Furin UTSW 7 80,043,240 (GRCm39) missense probably damaging 1.00
R6945:Furin UTSW 7 80,040,838 (GRCm39) missense possibly damaging 0.82
R6954:Furin UTSW 7 80,046,712 (GRCm39) missense possibly damaging 0.79
R7396:Furin UTSW 7 80,047,862 (GRCm39) missense probably benign 0.00
R7510:Furin UTSW 7 80,043,333 (GRCm39) missense probably damaging 1.00
R7542:Furin UTSW 7 80,043,207 (GRCm39) missense probably damaging 1.00
R7577:Furin UTSW 7 80,046,734 (GRCm39) missense probably damaging 1.00
R7812:Furin UTSW 7 80,045,722 (GRCm39) missense possibly damaging 0.94
R7995:Furin UTSW 7 80,045,195 (GRCm39) missense probably damaging 1.00
R8351:Furin UTSW 7 80,048,470 (GRCm39) missense probably benign 0.00
R8389:Furin UTSW 7 80,040,627 (GRCm39) missense probably benign 0.00
R8451:Furin UTSW 7 80,048,470 (GRCm39) missense probably benign 0.00
R8691:Furin UTSW 7 80,041,775 (GRCm39) unclassified probably benign
R8917:Furin UTSW 7 80,048,437 (GRCm39) missense probably benign
R9282:Furin UTSW 7 80,040,846 (GRCm39) missense probably benign 0.00
R9380:Furin UTSW 7 80,041,506 (GRCm39) missense probably benign 0.00
R9786:Furin UTSW 7 80,040,645 (GRCm39) missense probably benign 0.29
X0050:Furin UTSW 7 80,045,160 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGATGGTTTTGCAGCCCG -3'
(R):5'- TAGCCCACTTCGTTCACAGG -3'

Sequencing Primer
(F):5'- AAGGGTCTGGGGAATCTCC -3'
(R):5'- ACTTCGTTCACAGGGCCGAG -3'
Posted On 2015-10-21