Incidental Mutation 'R4687:Arhgap17'
ID353762
Institutional Source Beutler Lab
Gene Symbol Arhgap17
Ensembl Gene ENSMUSG00000030766
Gene NameRho GTPase activating protein 17
SynonymsNadrin2, Nadrin, WBP15, 5730403H17Rik, Rich1
MMRRC Submission 041938-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4687 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location123279218-123369915 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 123321603 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 149 (D149V)
Ref Sequence ENSEMBL: ENSMUSP00000145627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098060] [ENSMUST00000106442] [ENSMUST00000167309] [ENSMUST00000205262] [ENSMUST00000205936] [ENSMUST00000206117] [ENSMUST00000207010]
Predicted Effect probably damaging
Transcript: ENSMUST00000098060
AA Change: D149V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095668
Gene: ENSMUSG00000030766
AA Change: D149V

DomainStartEndE-ValueType
BAR 1 239 4.45e-65 SMART
RhoGAP 263 439 1.2e-60 SMART
low complexity region 554 595 N/A INTRINSIC
low complexity region 624 640 N/A INTRINSIC
low complexity region 644 664 N/A INTRINSIC
low complexity region 683 704 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106442
AA Change: D149V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102050
Gene: ENSMUSG00000030766
AA Change: D149V

DomainStartEndE-ValueType
BAR 1 239 4.45e-65 SMART
RhoGAP 263 439 1.2e-60 SMART
low complexity region 542 557 N/A INTRINSIC
low complexity region 570 582 N/A INTRINSIC
low complexity region 632 673 N/A INTRINSIC
low complexity region 702 718 N/A INTRINSIC
low complexity region 722 742 N/A INTRINSIC
low complexity region 761 782 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167309
AA Change: D149V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128447
Gene: ENSMUSG00000030766
AA Change: D149V

DomainStartEndE-ValueType
BAR 1 239 4.45e-65 SMART
RhoGAP 263 439 1.2e-60 SMART
low complexity region 542 557 N/A INTRINSIC
low complexity region 570 582 N/A INTRINSIC
low complexity region 632 673 N/A INTRINSIC
low complexity region 702 718 N/A INTRINSIC
low complexity region 722 742 N/A INTRINSIC
low complexity region 761 782 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000205262
AA Change: D149V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000205936
Predicted Effect probably damaging
Transcript: ENSMUST00000206117
AA Change: D149V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206294
Predicted Effect probably damaging
Transcript: ENSMUST00000207010
AA Change: D149V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RICH1 is a GTPase-activating protein (GAP). GAPs stimulate the intrinsic GTP hydrolysis of small G proteins, such as RHOA (MIM 165390), RAC1 (MIM 602048), and CDC42 (MIM 116952).[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T A 17: 8,992,153 Y45N probably damaging Het
Agbl3 T C 6: 34,798,326 V189A probably damaging Het
Akip1 C A 7: 109,704,986 S90* probably null Het
Amn A T 12: 111,276,068 D439V probably benign Het
Atp6v0a4 A T 6: 38,092,465 I76N possibly damaging Het
Atp6v1h A T 1: 5,133,085 N291I probably damaging Het
Baiap2l2 G T 15: 79,259,253 P462T probably damaging Het
Bves C T 10: 45,354,840 probably null Het
Cabp7 T A 11: 4,739,265 K127* probably null Het
Cacna1h A G 17: 25,393,910 V313A possibly damaging Het
Camkk2 T C 5: 122,753,724 H245R probably damaging Het
Celsr1 T A 15: 85,932,460 S1761C possibly damaging Het
Cfap46 T C 7: 139,627,456 E1849G possibly damaging Het
Ciz1 T C 2: 32,367,465 L174P probably damaging Het
Crim1 G T 17: 78,303,025 C303F probably damaging Het
Cyp26c1 A G 19: 37,692,937 Q396R probably damaging Het
Dnajc7 G A 11: 100,599,300 P43L probably damaging Het
Dpf2 T C 19: 5,907,012 H16R probably damaging Het
Dsp A G 13: 38,191,619 T1127A probably damaging Het
Dst T C 1: 34,201,123 L1525P probably damaging Het
Ehf T A 2: 103,267,126 D192V probably damaging Het
Frem1 G T 4: 83,020,631 N71K probably damaging Het
Furin T A 7: 80,393,447 T339S probably benign Het
Gad1 T A 2: 70,600,720 I569N possibly damaging Het
Gfi1 T C 5: 107,723,810 K10R probably damaging Het
Gm20775 T A Y: 10,641,258 noncoding transcript Homo
Gpn3 A C 5: 122,378,575 D89A possibly damaging Het
Gpr18 T A 14: 121,911,678 R312* probably null Het
Gsap T C 5: 21,246,971 probably benign Het
H2-Ab1 C A 17: 34,264,809 T48K probably damaging Het
Hmcn2 A T 2: 31,438,285 N4326I probably benign Het
Igkv4-51 A C 6: 69,681,730 probably benign Het
Insr T C 8: 3,161,709 H1104R probably benign Het
Ipo13 A T 4: 117,901,576 N697K probably benign Het
Iqcm T G 8: 75,762,989 F362V probably damaging Het
Irak4 T C 15: 94,566,823 S425P probably damaging Het
Jakmip2 T C 18: 43,577,412 E242G possibly damaging Het
Kdm4a T C 4: 118,144,083 K829R probably damaging Het
Kdr T C 5: 75,968,792 N145S possibly damaging Het
Klra9 A T 6: 130,185,517 D185E probably benign Het
Lcn12 T C 2: 25,493,321 N15S probably benign Het
Mei4 T A 9: 81,927,317 M151K probably damaging Het
Mmp3 T A 9: 7,451,223 S320T probably benign Het
Mrps5 C G 2: 127,590,770 A37G probably benign Het
Mttp A G 3: 138,092,735 I800T possibly damaging Het
Nags A T 11: 102,148,196 Q451L probably damaging Het
Nbea T C 3: 56,058,065 T476A probably damaging Het
Ndufb10 T C 17: 24,722,419 E145G possibly damaging Het
Neb T G 2: 52,304,035 S660R possibly damaging Het
Nppb A G 4: 147,986,296 K43E probably benign Het
Nup188 A T 2: 30,330,633 Q906L probably benign Het
Olfr1259 T C 2: 89,943,869 D82G probably damaging Het
Olfr1413 T C 1: 92,573,330 I53T possibly damaging Het
Olfr370 T A 8: 83,541,860 S239T probably damaging Het
Olfr895 C A 9: 38,269,414 N292K probably damaging Het
Ovch2 T A 7: 107,796,548 I88F possibly damaging Het
Palm3 A G 8: 84,029,935 E692G probably benign Het
Pcsk6 T C 7: 65,983,753 F578L probably damaging Het
Piezo2 A C 18: 63,069,963 D1535E probably damaging Het
Ppp1r15b T C 1: 133,132,135 V130A probably benign Het
Proca1 T C 11: 78,204,898 Y32H probably damaging Het
Prtg T A 9: 72,890,798 V682E probably damaging Het
Pyroxd1 A T 6: 142,361,868 M455L probably benign Het
Rasa1 T C 13: 85,226,635 D739G possibly damaging Het
Scn3a T C 2: 65,464,730 I1550V possibly damaging Het
Sepsecs T C 5: 52,643,871 D483G probably benign Het
Setd7 T C 3: 51,550,355 D17G probably damaging Het
Sipa1l2 C T 8: 125,491,245 C451Y probably damaging Het
Slc31a1 A G 4: 62,388,702 Y165C probably damaging Het
Smg5 T C 3: 88,342,469 F68L possibly damaging Het
Sptbn5 A G 2: 120,077,208 probably benign Het
Stk3 A G 15: 35,114,565 I65T probably damaging Het
Tas2r115 C T 6: 132,737,284 A235T possibly damaging Het
Tenm2 C T 11: 36,049,097 A1400T probably benign Het
Tet1 T A 10: 62,838,791 N1169Y probably benign Het
Treml2 T A 17: 48,309,397 probably null Het
Tspan11 A G 6: 127,938,235 E104G probably damaging Het
Wdtc1 G A 4: 133,296,431 A543V probably damaging Het
Zfp148 T A 16: 33,496,819 D578E probably damaging Het
Zfp735 A T 11: 73,711,855 N542Y probably damaging Het
Zfp735 A T 11: 73,711,856 N542I probably damaging Het
Zfp869 T A 8: 69,708,143 E65D probably benign Het
Other mutations in Arhgap17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01012:Arhgap17 APN 7 123286568 utr 3 prime probably benign
IGL02112:Arhgap17 APN 7 123318417 missense possibly damaging 0.92
IGL02117:Arhgap17 APN 7 123286773 utr 3 prime probably benign
IGL03062:Arhgap17 APN 7 123321874 splice site probably null
gensing UTSW 7 123314690 missense probably damaging 1.00
Nightshade UTSW 7 123327244 missense probably damaging 1.00
tuberose UTSW 7 123308377 missense probably damaging 1.00
yam UTSW 7 123306420 missense probably damaging 1.00
P0028:Arhgap17 UTSW 7 123286677 utr 3 prime probably benign
R0480:Arhgap17 UTSW 7 123294644 missense probably damaging 0.98
R0593:Arhgap17 UTSW 7 123286743 utr 3 prime probably benign
R0594:Arhgap17 UTSW 7 123294518 missense probably benign 0.00
R0599:Arhgap17 UTSW 7 123303790 splice site probably benign
R0751:Arhgap17 UTSW 7 123314690 missense probably damaging 1.00
R1184:Arhgap17 UTSW 7 123314690 missense probably damaging 1.00
R1791:Arhgap17 UTSW 7 123286702 missense probably benign 0.23
R2036:Arhgap17 UTSW 7 123318494 missense possibly damaging 0.92
R3428:Arhgap17 UTSW 7 123323631 missense probably damaging 1.00
R4032:Arhgap17 UTSW 7 123280066 utr 3 prime probably benign
R4119:Arhgap17 UTSW 7 123306994 missense probably damaging 1.00
R4652:Arhgap17 UTSW 7 123286618 utr 3 prime probably benign
R4910:Arhgap17 UTSW 7 123308377 missense probably damaging 1.00
R4960:Arhgap17 UTSW 7 123286926 utr 3 prime probably benign
R4963:Arhgap17 UTSW 7 123308360 missense possibly damaging 0.91
R5028:Arhgap17 UTSW 7 123294673 missense probably benign 0.05
R5253:Arhgap17 UTSW 7 123303748 missense probably benign 0.00
R5316:Arhgap17 UTSW 7 123296527 missense possibly damaging 0.63
R5410:Arhgap17 UTSW 7 123297493 critical splice donor site probably null
R5890:Arhgap17 UTSW 7 123286758 utr 3 prime probably benign
R6367:Arhgap17 UTSW 7 123308363 makesense probably null
R6376:Arhgap17 UTSW 7 123300504 missense probably damaging 1.00
R6513:Arhgap17 UTSW 7 123292156 missense possibly damaging 0.87
R6862:Arhgap17 UTSW 7 123321901 missense probably damaging 0.98
R6962:Arhgap17 UTSW 7 123296432 missense probably damaging 1.00
R7077:Arhgap17 UTSW 7 123280008 missense unknown
R7178:Arhgap17 UTSW 7 123285358 splice site probably null
R7205:Arhgap17 UTSW 7 123306438 missense probably damaging 1.00
R7342:Arhgap17 UTSW 7 123327244 missense probably damaging 1.00
R7524:Arhgap17 UTSW 7 123306420 missense probably damaging 1.00
R7812:Arhgap17 UTSW 7 123280067 missense unknown
R7901:Arhgap17 UTSW 7 123286568 utr 3 prime probably benign
R7950:Arhgap17 UTSW 7 123286816 missense probably benign 0.23
R7952:Arhgap17 UTSW 7 123286691 missense probably benign 0.23
RF009:Arhgap17 UTSW 7 123286862 small deletion probably benign
RF015:Arhgap17 UTSW 7 123286862 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- CTTGGTGGCTCACTTAGTTCAG -3'
(R):5'- ATCAGCGGCTTTAATGTAGACC -3'

Sequencing Primer
(F):5'- ACTTAGTTCAGGATGCTCTAGC -3'
(R):5'- CAGCGGCTTTAATGTAGACCTATTTG -3'
Posted On2015-10-21