Mutagenetix > Incidental Mutation

Incidental Mutation 'R4687:Insr'

353764

Institutional Source

Beutler Lab

Gene Symbol

Insr

Ensembl Gene

ENSMUSG00000005534

Gene Name

insulin receptor

Synonyms

IR-A, IR-B, D630014A15Rik, 4932439J01Rik, IR, CD220

MMRRC Submission

041938-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.861) question?

Stock #

R4687 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

3122061-3279617 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 3161709 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 1104 (H1104R)

Ref Sequence

ENSEMBL: ENSMUSP00000088837 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091291]

AlphaFold

P15208

PDB Structure

1.35A crystal structure of H-2Kb complexed with the GNYSFYAL peptide [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000091291
AA Change: H1104R

PolyPhen 2 Score 0.418 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000088837
Gene: ENSMUSG00000005534
AA Change: H1104R

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:Recep_L_domain	52	164	5e-28	PFAM
FU	231	274	1.66e-10	SMART
Pfam:Recep_L_domain	359	473	2.5e-30	PFAM
FN3	496	602	4.02e1	SMART
FN3	624	821	1.16e-6	SMART
FN3	841	924	3.17e-4	SMART
transmembrane domain	947	969	N/A	INTRINSIC
TyrKc	1013	1280	3.11e-134	SMART
low complexity region	1303	1315	N/A	INTRINSIC
low complexity region	1327	1336	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000208839

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the receptor tyrosine kinase family of transmembrane signaling proteins that play important roles in cell differentiation, growth and metabolism. The encoded preproprotein undergoes proteolytic processing to generate alpha and beta chains that form a disulfide-linked heterodimer which, in turn homodimerizes to form a mature, functional receptor. Mice lacking the encoded protein develop severe hyperglycemia and hyperketonemia, and die within a couple of days after birth as a result of diabetic ketoacidosis. [provided by RefSeq, Aug 2016]
PHENOTYPE: Null mutants grow slowly and die by 7 days of age with ketoacidosis, high serum insulin and triglycerides, low glycogen stores and fatty livers. Tissue specific knockouts show milder lipid metabolism anomalies. Point mutation heterozygotes exhibit hyperglycemia, hyperinsulinemia and glucosuria. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700010I14Rik	T	A	17: 8,992,153	Y45N	probably damaging	Het
Agbl3	T	C	6: 34,798,326	V189A	probably damaging	Het
Akip1	C	A	7: 109,704,986	S90*	probably null	Het
Amn	A	T	12: 111,276,068	D439V	probably benign	Het
Arhgap17	T	A	7: 123,321,603	D149V	probably damaging	Het
Atp6v0a4	A	T	6: 38,092,465	I76N	possibly damaging	Het
Atp6v1h	A	T	1: 5,133,085	N291I	probably damaging	Het
Baiap2l2	G	T	15: 79,259,253	P462T	probably damaging	Het
Bves	C	T	10: 45,354,840		probably null	Het
Cabp7	T	A	11: 4,739,265	K127*	probably null	Het
Cacna1h	A	G	17: 25,393,910	V313A	possibly damaging	Het
Camkk2	T	C	5: 122,753,724	H245R	probably damaging	Het
Celsr1	T	A	15: 85,932,460	S1761C	possibly damaging	Het
Cfap46	T	C	7: 139,627,456	E1849G	possibly damaging	Het
Ciz1	T	C	2: 32,367,465	L174P	probably damaging	Het
Crim1	G	T	17: 78,303,025	C303F	probably damaging	Het
Cyp26c1	A	G	19: 37,692,937	Q396R	probably damaging	Het
Dnajc7	G	A	11: 100,599,300	P43L	probably damaging	Het
Dpf2	T	C	19: 5,907,012	H16R	probably damaging	Het
Dsp	A	G	13: 38,191,619	T1127A	probably damaging	Het
Dst	T	C	1: 34,201,123	L1525P	probably damaging	Het
Ehf	T	A	2: 103,267,126	D192V	probably damaging	Het
Frem1	G	T	4: 83,020,631	N71K	probably damaging	Het
Furin	T	A	7: 80,393,447	T339S	probably benign	Het
Gad1	T	A	2: 70,600,720	I569N	possibly damaging	Het
Gfi1	T	C	5: 107,723,810	K10R	probably damaging	Het
Gm20775	T	A	Y: 10,641,258		noncoding transcript	Homo
Gpn3	A	C	5: 122,378,575	D89A	possibly damaging	Het
Gpr18	T	A	14: 121,911,678	R312*	probably null	Het
Gsap	T	C	5: 21,246,971		probably benign	Het
H2-Ab1	C	A	17: 34,264,809	T48K	probably damaging	Het
Hmcn2	A	T	2: 31,438,285	N4326I	probably benign	Het
Igkv4-51	A	C	6: 69,681,730		probably benign	Het
Ipo13	A	T	4: 117,901,576	N697K	probably benign	Het
Iqcm	T	G	8: 75,762,989	F362V	probably damaging	Het
Irak4	T	C	15: 94,566,823	S425P	probably damaging	Het
Jakmip2	T	C	18: 43,577,412	E242G	possibly damaging	Het
Kdm4a	T	C	4: 118,144,083	K829R	probably damaging	Het
Kdr	T	C	5: 75,968,792	N145S	possibly damaging	Het
Klra9	A	T	6: 130,185,517	D185E	probably benign	Het
Lcn12	T	C	2: 25,493,321	N15S	probably benign	Het
Mei4	T	A	9: 81,927,317	M151K	probably damaging	Het
Mmp3	T	A	9: 7,451,223	S320T	probably benign	Het
Mrps5	C	G	2: 127,590,770	A37G	probably benign	Het
Mttp	A	G	3: 138,092,735	I800T	possibly damaging	Het
Nags	A	T	11: 102,148,196	Q451L	probably damaging	Het
Nbea	T	C	3: 56,058,065	T476A	probably damaging	Het
Ndufb10	T	C	17: 24,722,419	E145G	possibly damaging	Het
Neb	T	G	2: 52,304,035	S660R	possibly damaging	Het
Nppb	A	G	4: 147,986,296	K43E	probably benign	Het
Nup188	A	T	2: 30,330,633	Q906L	probably benign	Het
Olfr1259	T	C	2: 89,943,869	D82G	probably damaging	Het
Olfr1413	T	C	1: 92,573,330	I53T	possibly damaging	Het
Olfr370	T	A	8: 83,541,860	S239T	probably damaging	Het
Olfr895	C	A	9: 38,269,414	N292K	probably damaging	Het
Ovch2	T	A	7: 107,796,548	I88F	possibly damaging	Het
Palm3	A	G	8: 84,029,935	E692G	probably benign	Het
Pcsk6	T	C	7: 65,983,753	F578L	probably damaging	Het
Piezo2	A	C	18: 63,069,963	D1535E	probably damaging	Het
Ppp1r15b	T	C	1: 133,132,135	V130A	probably benign	Het
Proca1	T	C	11: 78,204,898	Y32H	probably damaging	Het
Prtg	T	A	9: 72,890,798	V682E	probably damaging	Het
Pyroxd1	A	T	6: 142,361,868	M455L	probably benign	Het
Rasa1	T	C	13: 85,226,635	D739G	possibly damaging	Het
Scn3a	T	C	2: 65,464,730	I1550V	possibly damaging	Het
Sepsecs	T	C	5: 52,643,871	D483G	probably benign	Het
Setd7	T	C	3: 51,550,355	D17G	probably damaging	Het
Sipa1l2	C	T	8: 125,491,245	C451Y	probably damaging	Het
Slc31a1	A	G	4: 62,388,702	Y165C	probably damaging	Het
Smg5	T	C	3: 88,342,469	F68L	possibly damaging	Het
Sptbn5	A	G	2: 120,077,208		probably benign	Het
Stk3	A	G	15: 35,114,565	I65T	probably damaging	Het
Tas2r115	C	T	6: 132,737,284	A235T	possibly damaging	Het
Tenm2	C	T	11: 36,049,097	A1400T	probably benign	Het
Tet1	T	A	10: 62,838,791	N1169Y	probably benign	Het
Treml2	T	A	17: 48,309,397		probably null	Het
Tspan11	A	G	6: 127,938,235	E104G	probably damaging	Het
Wdtc1	G	A	4: 133,296,431	A543V	probably damaging	Het
Zfp148	T	A	16: 33,496,819	D578E	probably damaging	Het
Zfp735	A	T	11: 73,711,855	N542Y	probably damaging	Het
Zfp735	A	T	11: 73,711,856	N542I	probably damaging	Het
Zfp869	T	A	8: 69,708,143	E65D	probably benign	Het

Other mutations in Insr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01099:Insr	APN	8	3258682	missense	probably damaging	1.00
IGL01986:Insr	APN	8	3158817	missense	probably damaging	1.00
IGL02135:Insr	APN	8	3258741	missense	probably damaging	1.00
IGL02203:Insr	APN	8	3155817	missense	probably benign	0.18
IGL02220:Insr	APN	8	3159578	missense	probably damaging	1.00
IGL02678:Insr	APN	8	3173570	missense	probably benign	0.00
IGL02961:Insr	APN	8	3258785	missense	probably benign	0.08
IGL03099:Insr	APN	8	3258715	missense	probably damaging	1.00
IGL03125:Insr	APN	8	3184972	missense	possibly damaging	0.87
IGL03290:Insr	APN	8	3258574	missense	probably damaging	1.00
gummi_bear	UTSW	8	3161770	missense	probably damaging	1.00
jellybelly	UTSW	8	3258841	missense	probably damaging	1.00
Patently	UTSW	8	3159475	missense	probably damaging	1.00
trolli	UTSW	8	3198111	missense	probably benign	0.31
R0047:Insr	UTSW	8	3202947	missense	probably damaging	0.97
R0053:Insr	UTSW	8	3155683	missense	probably damaging	1.00
R0053:Insr	UTSW	8	3155683	missense	probably damaging	1.00
R0480:Insr	UTSW	8	3161770	missense	probably damaging	1.00
R0748:Insr	UTSW	8	3258841	missense	probably damaging	1.00
R0919:Insr	UTSW	8	3158769	missense	probably damaging	1.00
R1348:Insr	UTSW	8	3192635	missense	probably damaging	1.00
R1467:Insr	UTSW	8	3169720	missense	probably damaging	0.99
R1467:Insr	UTSW	8	3169720	missense	probably damaging	0.99
R1568:Insr	UTSW	8	3165576	missense	probably benign
R1768:Insr	UTSW	8	3159561	missense	probably damaging	1.00
R2093:Insr	UTSW	8	3204762	missense	probably damaging	1.00
R2111:Insr	UTSW	8	3169748	missense	probably benign	0.17
R2112:Insr	UTSW	8	3169748	missense	probably benign	0.17
R2352:Insr	UTSW	8	3192593	missense	probably damaging	1.00
R2364:Insr	UTSW	8	3174820	missense	probably benign
R2842:Insr	UTSW	8	3202986	missense	probably damaging	1.00
R3162:Insr	UTSW	8	3161416	missense	possibly damaging	0.65
R3162:Insr	UTSW	8	3161416	missense	possibly damaging	0.65
R4081:Insr	UTSW	8	3211391	missense	probably benign	0.00
R4441:Insr	UTSW	8	3194902	missense	probably benign	0.00
R4672:Insr	UTSW	8	3167501	critical splice donor site	probably null
R4708:Insr	UTSW	8	3211346	intron	probably benign
R4890:Insr	UTSW	8	3198234	missense	probably benign	0.16
R4949:Insr	UTSW	8	3185059	missense	probably benign	0.04
R4996:Insr	UTSW	8	3192665	missense	probably null	0.98
R5073:Insr	UTSW	8	3159475	missense	probably damaging	1.00
R5176:Insr	UTSW	8	3158742	missense	probably benign	0.03
R5200:Insr	UTSW	8	3198059	critical splice donor site	probably null
R5323:Insr	UTSW	8	3202902	missense	probably benign	0.02
R5453:Insr	UTSW	8	3155694	missense	probably benign	0.06
R5516:Insr	UTSW	8	3155764	nonsense	probably null
R5704:Insr	UTSW	8	3185122	missense	possibly damaging	0.52
R5820:Insr	UTSW	8	3155976	missense	probably damaging	1.00
R5879:Insr	UTSW	8	3198173	nonsense	probably null
R5894:Insr	UTSW	8	3174869	missense	possibly damaging	0.88
R5937:Insr	UTSW	8	3174808	missense	probably benign
R5966:Insr	UTSW	8	3258697	missense	probably benign	0.04
R6134:Insr	UTSW	8	3192572	missense	probably damaging	1.00
R6352:Insr	UTSW	8	3173479	critical splice donor site	probably null
R6423:Insr	UTSW	8	3173566	missense	probably benign
R6687:Insr	UTSW	8	3198111	missense	probably benign	0.31
R6985:Insr	UTSW	8	3161372	missense	possibly damaging	0.87
R6993:Insr	UTSW	8	3258752	missense	probably damaging	1.00
R7041:Insr	UTSW	8	3258418	missense	probably benign
R7109:Insr	UTSW	8	3258481	missense	probably benign	0.33
R7216:Insr	UTSW	8	3203034	missense	possibly damaging	0.53
R7287:Insr	UTSW	8	3169717	missense	probably benign	0.00
R7378:Insr	UTSW	8	3198231	missense	probably damaging	1.00
R7525:Insr	UTSW	8	3192642	missense	probably damaging	1.00
R7572:Insr	UTSW	8	3173602	missense	probably benign	0.11
R7636:Insr	UTSW	8	3258709	missense	probably damaging	1.00
R7684:Insr	UTSW	8	3169753	missense	possibly damaging	0.85
R7840:Insr	UTSW	8	3258415	missense	probably benign	0.04
R8075:Insr	UTSW	8	3155862	missense	probably benign	0.17
R8161:Insr	UTSW	8	3258660	missense	probably damaging	1.00
R8220:Insr	UTSW	8	3158702	missense	probably benign	0.01
R8434:Insr	UTSW	8	3165514	splice site	probably benign
R8810:Insr	UTSW	8	3169714	missense	probably benign
R8865:Insr	UTSW	8	3161358	missense	probably damaging	1.00
R8884:Insr	UTSW	8	3155679	missense	probably benign
R9134:Insr	UTSW	8	3258413	missense	probably damaging	1.00
R9359:Insr	UTSW	8	3158717	missense	probably damaging	1.00
R9407:Insr	UTSW	8	3185106	missense	probably benign
R9647:Insr	UTSW	8	3155874	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- GCGGCCTGGGTTATTCTAAAGTC -3'
(R):5'- GCCCGTGTTTTACTGTTACCAG -3'

Sequencing Primer
(F):5'- GGCCTGGGTTATTCTAAAGTCAAAAC -3'
(R):5'- TACTGTTACCAGAGAGAGCATTGTG -3'

Posted On

2015-10-21