Incidental Mutation 'R4687:Mmp3'
ID 353770
Institutional Source Beutler Lab
Gene Symbol Mmp3
Ensembl Gene ENSMUSG00000043613
Gene Name matrix metallopeptidase 3
Synonyms Stmy1, SLN-1, Str1, stromelysin 1, STR-1, stromelysin-1, SLN1, progelatinase
MMRRC Submission 041938-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # R4687 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 7445822-7455975 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 7451223 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 320 (S320T)
Ref Sequence ENSEMBL: ENSMUSP00000034497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034497]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000034497
AA Change: S320T

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000034497
Gene: ENSMUSG00000043613
AA Change: S320T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:PG_binding_1 29 89 1.7e-12 PFAM
ZnMc 107 267 6.24e-65 SMART
HX 298 340 4.56e-9 SMART
HX 342 385 2.87e-6 SMART
HX 390 437 4.73e-16 SMART
HX 439 479 3.3e-6 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded protein is activated by the removal of an N-temrinal activation peptide to generate a zinc-dependent endopeptidase with a broad range of substrates such as proteoglycans, laminin, fibronectin, elastin, and collagens. This gene is located in a cluster of other matrix metalloproteinase genes on chromosome 9. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for disrutptions in this gene display abnormalities of the immune system as well as minor structural abnormalities in the neuromuscular junction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T A 17: 9,210,985 (GRCm39) Y45N probably damaging Het
Agbl3 T C 6: 34,775,261 (GRCm39) V189A probably damaging Het
Akip1 C A 7: 109,304,193 (GRCm39) S90* probably null Het
Amn A T 12: 111,242,502 (GRCm39) D439V probably benign Het
Arhgap17 T A 7: 122,920,826 (GRCm39) D149V probably damaging Het
Atp6v0a4 A T 6: 38,069,400 (GRCm39) I76N possibly damaging Het
Atp6v1h A T 1: 5,203,308 (GRCm39) N291I probably damaging Het
Baiap2l2 G T 15: 79,143,453 (GRCm39) P462T probably damaging Het
Bves C T 10: 45,230,936 (GRCm39) probably null Het
Cabp7 T A 11: 4,689,265 (GRCm39) K127* probably null Het
Cacna1h A G 17: 25,612,884 (GRCm39) V313A possibly damaging Het
Camkk2 T C 5: 122,891,787 (GRCm39) H245R probably damaging Het
Celsr1 T A 15: 85,816,661 (GRCm39) S1761C possibly damaging Het
Cfap46 T C 7: 139,207,372 (GRCm39) E1849G possibly damaging Het
Ciz1 T C 2: 32,257,477 (GRCm39) L174P probably damaging Het
Crim1 G T 17: 78,610,454 (GRCm39) C303F probably damaging Het
Cyp26c1 A G 19: 37,681,385 (GRCm39) Q396R probably damaging Het
Dnajc7 G A 11: 100,490,126 (GRCm39) P43L probably damaging Het
Dpf2 T C 19: 5,957,040 (GRCm39) H16R probably damaging Het
Dsp A G 13: 38,375,595 (GRCm39) T1127A probably damaging Het
Dst T C 1: 34,240,204 (GRCm39) L1525P probably damaging Het
Ehf T A 2: 103,097,471 (GRCm39) D192V probably damaging Het
Frem1 G T 4: 82,938,868 (GRCm39) N71K probably damaging Het
Furin T A 7: 80,043,195 (GRCm39) T339S probably benign Het
Gad1 T A 2: 70,431,064 (GRCm39) I569N possibly damaging Het
Gfi1 T C 5: 107,871,676 (GRCm39) K10R probably damaging Het
Gm20775 T A Y: 10,641,258 (GRCm39) noncoding transcript Homo
Gpn3 A C 5: 122,516,638 (GRCm39) D89A possibly damaging Het
Gpr18 T A 14: 122,149,090 (GRCm39) R312* probably null Het
Gsap T C 5: 21,451,969 (GRCm39) probably benign Het
H2-Ab1 C A 17: 34,483,783 (GRCm39) T48K probably damaging Het
Hmcn2 A T 2: 31,328,297 (GRCm39) N4326I probably benign Het
Igkv4-51 A C 6: 69,658,714 (GRCm39) probably benign Het
Insr T C 8: 3,211,709 (GRCm39) H1104R probably benign Het
Ipo13 A T 4: 117,758,773 (GRCm39) N697K probably benign Het
Iqcm T G 8: 76,489,617 (GRCm39) F362V probably damaging Het
Irak4 T C 15: 94,464,704 (GRCm39) S425P probably damaging Het
Jakmip2 T C 18: 43,710,477 (GRCm39) E242G possibly damaging Het
Kdm4a T C 4: 118,001,280 (GRCm39) K829R probably damaging Het
Kdr T C 5: 76,129,452 (GRCm39) N145S possibly damaging Het
Klra9 A T 6: 130,162,480 (GRCm39) D185E probably benign Het
Lcn12 T C 2: 25,383,333 (GRCm39) N15S probably benign Het
Mei4 T A 9: 81,809,370 (GRCm39) M151K probably damaging Het
Mrps5 C G 2: 127,432,690 (GRCm39) A37G probably benign Het
Mttp A G 3: 137,798,496 (GRCm39) I800T possibly damaging Het
Nags A T 11: 102,039,022 (GRCm39) Q451L probably damaging Het
Nbea T C 3: 55,965,486 (GRCm39) T476A probably damaging Het
Ndufb10 T C 17: 24,941,393 (GRCm39) E145G possibly damaging Het
Neb T G 2: 52,194,047 (GRCm39) S660R possibly damaging Het
Nppb A G 4: 148,070,753 (GRCm39) K43E probably benign Het
Nup188 A T 2: 30,220,645 (GRCm39) Q906L probably benign Het
Or10k2 T A 8: 84,268,489 (GRCm39) S239T probably damaging Het
Or4c12 T C 2: 89,774,213 (GRCm39) D82G probably damaging Het
Or8c17 C A 9: 38,180,710 (GRCm39) N292K probably damaging Het
Or9s23 T C 1: 92,501,052 (GRCm39) I53T possibly damaging Het
Ovch2 T A 7: 107,395,755 (GRCm39) I88F possibly damaging Het
Palm3 A G 8: 84,756,564 (GRCm39) E692G probably benign Het
Pcsk6 T C 7: 65,633,501 (GRCm39) F578L probably damaging Het
Piezo2 A C 18: 63,203,034 (GRCm39) D1535E probably damaging Het
Ppp1r15b T C 1: 133,059,873 (GRCm39) V130A probably benign Het
Proca1 T C 11: 78,095,724 (GRCm39) Y32H probably damaging Het
Prtg T A 9: 72,798,080 (GRCm39) V682E probably damaging Het
Pyroxd1 A T 6: 142,307,594 (GRCm39) M455L probably benign Het
Rasa1 T C 13: 85,374,754 (GRCm39) D739G possibly damaging Het
Scn3a T C 2: 65,295,074 (GRCm39) I1550V possibly damaging Het
Sepsecs T C 5: 52,801,213 (GRCm39) D483G probably benign Het
Setd7 T C 3: 51,457,776 (GRCm39) D17G probably damaging Het
Sipa1l2 C T 8: 126,217,984 (GRCm39) C451Y probably damaging Het
Slc31a1 A G 4: 62,306,939 (GRCm39) Y165C probably damaging Het
Smg5 T C 3: 88,249,776 (GRCm39) F68L possibly damaging Het
Sptbn5 A G 2: 119,907,689 (GRCm39) probably benign Het
Stk3 A G 15: 35,114,711 (GRCm39) I65T probably damaging Het
Tas2r115 C T 6: 132,714,247 (GRCm39) A235T possibly damaging Het
Tenm2 C T 11: 35,939,924 (GRCm39) A1400T probably benign Het
Tet1 T A 10: 62,674,570 (GRCm39) N1169Y probably benign Het
Treml2 T A 17: 48,616,425 (GRCm39) probably null Het
Tspan11 A G 6: 127,915,198 (GRCm39) E104G probably damaging Het
Wdtc1 G A 4: 133,023,742 (GRCm39) A543V probably damaging Het
Zfp148 T A 16: 33,317,189 (GRCm39) D578E probably damaging Het
Zfp735 A T 11: 73,602,682 (GRCm39) N542I probably damaging Het
Zfp735 A T 11: 73,602,681 (GRCm39) N542Y probably damaging Het
Zfp869 T A 8: 70,160,793 (GRCm39) E65D probably benign Het
Other mutations in Mmp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Mmp3 APN 9 7,445,894 (GRCm39) utr 5 prime probably benign
IGL01738:Mmp3 APN 9 7,446,946 (GRCm39) missense possibly damaging 0.94
IGL02154:Mmp3 APN 9 7,453,662 (GRCm39) missense probably benign 0.19
IGL02212:Mmp3 APN 9 7,450,165 (GRCm39) missense probably damaging 1.00
IGL02568:Mmp3 APN 9 7,446,001 (GRCm39) missense probably benign 0.02
IGL03366:Mmp3 APN 9 7,450,149 (GRCm39) missense probably benign 0.00
R0047:Mmp3 UTSW 9 7,451,910 (GRCm39) splice site probably benign
R0047:Mmp3 UTSW 9 7,451,910 (GRCm39) splice site probably benign
R0356:Mmp3 UTSW 9 7,451,768 (GRCm39) missense probably benign 0.03
R0390:Mmp3 UTSW 9 7,451,320 (GRCm39) missense probably benign 0.29
R0401:Mmp3 UTSW 9 7,449,790 (GRCm39) missense probably damaging 1.00
R0466:Mmp3 UTSW 9 7,450,165 (GRCm39) missense probably damaging 1.00
R0549:Mmp3 UTSW 9 7,455,638 (GRCm39) missense probably benign 0.08
R0903:Mmp3 UTSW 9 7,445,994 (GRCm39) missense probably benign 0.00
R1438:Mmp3 UTSW 9 7,453,705 (GRCm39) missense probably benign 0.22
R1498:Mmp3 UTSW 9 7,446,967 (GRCm39) missense possibly damaging 0.95
R1515:Mmp3 UTSW 9 7,451,232 (GRCm39) missense probably benign 0.01
R1629:Mmp3 UTSW 9 7,447,641 (GRCm39) missense probably benign 0.00
R1844:Mmp3 UTSW 9 7,453,662 (GRCm39) missense probably benign 0.19
R1858:Mmp3 UTSW 9 7,451,799 (GRCm39) missense probably benign 0.08
R2099:Mmp3 UTSW 9 7,453,672 (GRCm39) missense probably benign 0.01
R2497:Mmp3 UTSW 9 7,450,131 (GRCm39) missense probably benign 0.00
R2571:Mmp3 UTSW 9 7,451,844 (GRCm39) missense possibly damaging 0.95
R4659:Mmp3 UTSW 9 7,453,673 (GRCm39) missense probably benign 0.00
R4717:Mmp3 UTSW 9 7,449,881 (GRCm39) missense possibly damaging 0.94
R4930:Mmp3 UTSW 9 7,447,640 (GRCm39) missense probably benign 0.02
R4932:Mmp3 UTSW 9 7,446,994 (GRCm39) missense probably benign 0.00
R5020:Mmp3 UTSW 9 7,445,984 (GRCm39) missense probably benign
R5384:Mmp3 UTSW 9 7,451,759 (GRCm39) nonsense probably null
R5385:Mmp3 UTSW 9 7,451,759 (GRCm39) nonsense probably null
R5408:Mmp3 UTSW 9 7,449,904 (GRCm39) missense probably damaging 0.98
R6268:Mmp3 UTSW 9 7,447,622 (GRCm39) missense possibly damaging 0.78
R7317:Mmp3 UTSW 9 7,446,937 (GRCm39) missense probably damaging 1.00
R7467:Mmp3 UTSW 9 7,450,125 (GRCm39) missense probably benign 0.07
R7467:Mmp3 UTSW 9 7,447,621 (GRCm39) missense possibly damaging 0.93
R8101:Mmp3 UTSW 9 7,446,985 (GRCm39) missense probably benign 0.19
R9098:Mmp3 UTSW 9 7,446,936 (GRCm39) missense probably damaging 1.00
R9486:Mmp3 UTSW 9 7,451,256 (GRCm39) missense possibly damaging 0.50
X0022:Mmp3 UTSW 9 7,449,857 (GRCm39) missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- GCAGACTTCTTTTGGAGGAGAG -3'
(R):5'- AGTACTGTTTACTTTCCTTCCAGAGG -3'

Sequencing Primer
(F):5'- AGAGGGAGAGGTGGGATTTTCC -3'
(R):5'- CCAGAGGCTTGTCTCACTAAG -3'
Posted On 2015-10-21