Incidental Mutation 'R4687:Or8c17'
ID 353771
Institutional Source Beutler Lab
Gene Symbol Or8c17
Ensembl Gene ENSMUSG00000096427
Gene Name olfactory receptor family 8 subfamily C member 17
Synonyms GA_x6K02T2PVTD-31962461-31963411, MOR170-1, Olfr895
MMRRC Submission 041938-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.071) question?
Stock # R4687 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 38179297-38181049 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 38180710 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 292 (N292K)
Ref Sequence ENSEMBL: ENSMUSP00000148605 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093864] [ENSMUST00000212156]
AlphaFold L7N210
Predicted Effect probably damaging
Transcript: ENSMUST00000093864
AA Change: N300K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091387
Gene: ENSMUSG00000096427
AA Change: N300K

DomainStartEndE-ValueType
Pfam:7tm_4 37 313 4.6e-47 PFAM
Pfam:7tm_1 47 246 3.4e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000212156
AA Change: N292K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T A 17: 9,210,985 (GRCm39) Y45N probably damaging Het
Agbl3 T C 6: 34,775,261 (GRCm39) V189A probably damaging Het
Akip1 C A 7: 109,304,193 (GRCm39) S90* probably null Het
Amn A T 12: 111,242,502 (GRCm39) D439V probably benign Het
Arhgap17 T A 7: 122,920,826 (GRCm39) D149V probably damaging Het
Atp6v0a4 A T 6: 38,069,400 (GRCm39) I76N possibly damaging Het
Atp6v1h A T 1: 5,203,308 (GRCm39) N291I probably damaging Het
Baiap2l2 G T 15: 79,143,453 (GRCm39) P462T probably damaging Het
Bves C T 10: 45,230,936 (GRCm39) probably null Het
Cabp7 T A 11: 4,689,265 (GRCm39) K127* probably null Het
Cacna1h A G 17: 25,612,884 (GRCm39) V313A possibly damaging Het
Camkk2 T C 5: 122,891,787 (GRCm39) H245R probably damaging Het
Celsr1 T A 15: 85,816,661 (GRCm39) S1761C possibly damaging Het
Cfap46 T C 7: 139,207,372 (GRCm39) E1849G possibly damaging Het
Ciz1 T C 2: 32,257,477 (GRCm39) L174P probably damaging Het
Crim1 G T 17: 78,610,454 (GRCm39) C303F probably damaging Het
Cyp26c1 A G 19: 37,681,385 (GRCm39) Q396R probably damaging Het
Dnajc7 G A 11: 100,490,126 (GRCm39) P43L probably damaging Het
Dpf2 T C 19: 5,957,040 (GRCm39) H16R probably damaging Het
Dsp A G 13: 38,375,595 (GRCm39) T1127A probably damaging Het
Dst T C 1: 34,240,204 (GRCm39) L1525P probably damaging Het
Ehf T A 2: 103,097,471 (GRCm39) D192V probably damaging Het
Frem1 G T 4: 82,938,868 (GRCm39) N71K probably damaging Het
Furin T A 7: 80,043,195 (GRCm39) T339S probably benign Het
Gad1 T A 2: 70,431,064 (GRCm39) I569N possibly damaging Het
Gfi1 T C 5: 107,871,676 (GRCm39) K10R probably damaging Het
Gm20775 T A Y: 10,641,258 (GRCm39) noncoding transcript Homo
Gpn3 A C 5: 122,516,638 (GRCm39) D89A possibly damaging Het
Gpr18 T A 14: 122,149,090 (GRCm39) R312* probably null Het
Gsap T C 5: 21,451,969 (GRCm39) probably benign Het
H2-Ab1 C A 17: 34,483,783 (GRCm39) T48K probably damaging Het
Hmcn2 A T 2: 31,328,297 (GRCm39) N4326I probably benign Het
Igkv4-51 A C 6: 69,658,714 (GRCm39) probably benign Het
Insr T C 8: 3,211,709 (GRCm39) H1104R probably benign Het
Ipo13 A T 4: 117,758,773 (GRCm39) N697K probably benign Het
Iqcm T G 8: 76,489,617 (GRCm39) F362V probably damaging Het
Irak4 T C 15: 94,464,704 (GRCm39) S425P probably damaging Het
Jakmip2 T C 18: 43,710,477 (GRCm39) E242G possibly damaging Het
Kdm4a T C 4: 118,001,280 (GRCm39) K829R probably damaging Het
Kdr T C 5: 76,129,452 (GRCm39) N145S possibly damaging Het
Klra9 A T 6: 130,162,480 (GRCm39) D185E probably benign Het
Lcn12 T C 2: 25,383,333 (GRCm39) N15S probably benign Het
Mei4 T A 9: 81,809,370 (GRCm39) M151K probably damaging Het
Mmp3 T A 9: 7,451,223 (GRCm39) S320T probably benign Het
Mrps5 C G 2: 127,432,690 (GRCm39) A37G probably benign Het
Mttp A G 3: 137,798,496 (GRCm39) I800T possibly damaging Het
Nags A T 11: 102,039,022 (GRCm39) Q451L probably damaging Het
Nbea T C 3: 55,965,486 (GRCm39) T476A probably damaging Het
Ndufb10 T C 17: 24,941,393 (GRCm39) E145G possibly damaging Het
Neb T G 2: 52,194,047 (GRCm39) S660R possibly damaging Het
Nppb A G 4: 148,070,753 (GRCm39) K43E probably benign Het
Nup188 A T 2: 30,220,645 (GRCm39) Q906L probably benign Het
Or10k2 T A 8: 84,268,489 (GRCm39) S239T probably damaging Het
Or4c12 T C 2: 89,774,213 (GRCm39) D82G probably damaging Het
Or9s23 T C 1: 92,501,052 (GRCm39) I53T possibly damaging Het
Ovch2 T A 7: 107,395,755 (GRCm39) I88F possibly damaging Het
Palm3 A G 8: 84,756,564 (GRCm39) E692G probably benign Het
Pcsk6 T C 7: 65,633,501 (GRCm39) F578L probably damaging Het
Piezo2 A C 18: 63,203,034 (GRCm39) D1535E probably damaging Het
Ppp1r15b T C 1: 133,059,873 (GRCm39) V130A probably benign Het
Proca1 T C 11: 78,095,724 (GRCm39) Y32H probably damaging Het
Prtg T A 9: 72,798,080 (GRCm39) V682E probably damaging Het
Pyroxd1 A T 6: 142,307,594 (GRCm39) M455L probably benign Het
Rasa1 T C 13: 85,374,754 (GRCm39) D739G possibly damaging Het
Scn3a T C 2: 65,295,074 (GRCm39) I1550V possibly damaging Het
Sepsecs T C 5: 52,801,213 (GRCm39) D483G probably benign Het
Setd7 T C 3: 51,457,776 (GRCm39) D17G probably damaging Het
Sipa1l2 C T 8: 126,217,984 (GRCm39) C451Y probably damaging Het
Slc31a1 A G 4: 62,306,939 (GRCm39) Y165C probably damaging Het
Smg5 T C 3: 88,249,776 (GRCm39) F68L possibly damaging Het
Sptbn5 A G 2: 119,907,689 (GRCm39) probably benign Het
Stk3 A G 15: 35,114,711 (GRCm39) I65T probably damaging Het
Tas2r115 C T 6: 132,714,247 (GRCm39) A235T possibly damaging Het
Tenm2 C T 11: 35,939,924 (GRCm39) A1400T probably benign Het
Tet1 T A 10: 62,674,570 (GRCm39) N1169Y probably benign Het
Treml2 T A 17: 48,616,425 (GRCm39) probably null Het
Tspan11 A G 6: 127,915,198 (GRCm39) E104G probably damaging Het
Wdtc1 G A 4: 133,023,742 (GRCm39) A543V probably damaging Het
Zfp148 T A 16: 33,317,189 (GRCm39) D578E probably damaging Het
Zfp735 A T 11: 73,602,682 (GRCm39) N542I probably damaging Het
Zfp735 A T 11: 73,602,681 (GRCm39) N542Y probably damaging Het
Zfp869 T A 8: 70,160,793 (GRCm39) E65D probably benign Het
Other mutations in Or8c17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Or8c17 APN 9 38,179,801 (GRCm39) splice site probably benign
IGL01477:Or8c17 APN 9 38,180,615 (GRCm39) missense possibly damaging 0.74
IGL02150:Or8c17 APN 9 38,180,564 (GRCm39) missense possibly damaging 0.56
R0616:Or8c17 UTSW 9 38,180,630 (GRCm39) missense probably benign 0.08
R0738:Or8c17 UTSW 9 38,180,421 (GRCm39) missense possibly damaging 0.93
R3155:Or8c17 UTSW 9 38,179,836 (GRCm39) start codon destroyed probably null 0.98
R3824:Or8c17 UTSW 9 38,179,814 (GRCm39) missense probably benign
R3825:Or8c17 UTSW 9 38,179,814 (GRCm39) missense probably benign
R4023:Or8c17 UTSW 9 38,180,757 (GRCm39) missense possibly damaging 0.83
R4692:Or8c17 UTSW 9 38,179,826 (GRCm39) nonsense probably null
R6171:Or8c17 UTSW 9 38,179,898 (GRCm39) nonsense probably null
R6736:Or8c17 UTSW 9 38,179,866 (GRCm39) missense probably damaging 1.00
R6950:Or8c17 UTSW 9 38,179,842 (GRCm39) missense probably damaging 1.00
R7256:Or8c17 UTSW 9 38,180,004 (GRCm39) missense probably damaging 0.98
R7774:Or8c17 UTSW 9 38,180,655 (GRCm39) missense probably damaging 0.99
R7937:Or8c17 UTSW 9 38,180,344 (GRCm39) missense probably benign 0.16
R8354:Or8c17 UTSW 9 38,180,513 (GRCm39) missense probably benign 0.02
R8772:Or8c17 UTSW 9 38,180,231 (GRCm39) missense probably benign 0.00
R8863:Or8c17 UTSW 9 38,180,655 (GRCm39) missense probably damaging 0.99
R9371:Or8c17 UTSW 9 38,179,926 (GRCm39) missense possibly damaging 0.94
Z1088:Or8c17 UTSW 9 38,179,908 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGGGCACTTGTGGTTCTCAC -3'
(R):5'- TCTTACAGAAGCAGTAGATATGACACC -3'

Sequencing Primer
(F):5'- GTGGTTCTCACATTATAACTGTTAGC -3'
(R):5'- GCAGTAGATATGACACCATCTTAAAC -3'
Posted On 2015-10-21