Incidental Mutation 'R4687:Proca1'
ID353779
Institutional Source Beutler Lab
Gene Symbol Proca1
Ensembl Gene ENSMUSG00000044122
Gene Nameprotein interacting with cyclin A1
Synonyms
MMRRC Submission 041938-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R4687 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location78193392-78205763 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78204898 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 32 (Y32H)
Ref Sequence ENSEMBL: ENSMUSP00000086022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002121] [ENSMUST00000060539] [ENSMUST00000078099] [ENSMUST00000108317]
Predicted Effect probably benign
Transcript: ENSMUST00000002121
SMART Domains Protein: ENSMUSP00000002121
Gene: ENSMUSG00000002052

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
Pfam:SPT6_acidic 37 127 8.8e-19 PFAM
low complexity region 146 164 N/A INTRINSIC
low complexity region 170 189 N/A INTRINSIC
low complexity region 192 203 N/A INTRINSIC
low complexity region 220 250 N/A INTRINSIC
low complexity region 252 267 N/A INTRINSIC
Pfam:HTH_44 305 432 1.3e-28 PFAM
low complexity region 494 509 N/A INTRINSIC
YqgFc 779 894 4.27e-21 SMART
Pfam:HHH_7 935 1038 3.1e-55 PFAM
Pfam:HHH_3 966 1036 5.2e-10 PFAM
Pfam:DLD 1051 1159 6.8e-39 PFAM
S1 1221 1282 2.8e-3 SMART
SH2 1332 1421 4.12e-11 SMART
low complexity region 1441 1454 N/A INTRINSIC
Blast:SH2 1455 1517 9e-19 BLAST
low complexity region 1586 1599 N/A INTRINSIC
low complexity region 1639 1664 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000060539
SMART Domains Protein: ENSMUSP00000050319
Gene: ENSMUSG00000044122

DomainStartEndE-ValueType
low complexity region 42 53 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000078099
AA Change: Y32H

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000086022
Gene: ENSMUSG00000044122
AA Change: Y32H

DomainStartEndE-ValueType
coiled coil region 92 121 N/A INTRINSIC
low complexity region 148 161 N/A INTRINSIC
low complexity region 198 212 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000108314
Predicted Effect possibly damaging
Transcript: ENSMUST00000108317
AA Change: Y119H

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103953
Gene: ENSMUSG00000044122
AA Change: Y119H

DomainStartEndE-ValueType
Blast:PA2c 33 99 2e-12 BLAST
SCOP:d1poc__ 55 102 5e-4 SMART
coiled coil region 179 208 N/A INTRINSIC
low complexity region 235 248 N/A INTRINSIC
low complexity region 285 299 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124772
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T A 17: 8,992,153 Y45N probably damaging Het
Agbl3 T C 6: 34,798,326 V189A probably damaging Het
Akip1 C A 7: 109,704,986 S90* probably null Het
Amn A T 12: 111,276,068 D439V probably benign Het
Arhgap17 T A 7: 123,321,603 D149V probably damaging Het
Atp6v0a4 A T 6: 38,092,465 I76N possibly damaging Het
Atp6v1h A T 1: 5,133,085 N291I probably damaging Het
Baiap2l2 G T 15: 79,259,253 P462T probably damaging Het
Bves C T 10: 45,354,840 probably null Het
Cabp7 T A 11: 4,739,265 K127* probably null Het
Cacna1h A G 17: 25,393,910 V313A possibly damaging Het
Camkk2 T C 5: 122,753,724 H245R probably damaging Het
Celsr1 T A 15: 85,932,460 S1761C possibly damaging Het
Cfap46 T C 7: 139,627,456 E1849G possibly damaging Het
Ciz1 T C 2: 32,367,465 L174P probably damaging Het
Crim1 G T 17: 78,303,025 C303F probably damaging Het
Cyp26c1 A G 19: 37,692,937 Q396R probably damaging Het
Dnajc7 G A 11: 100,599,300 P43L probably damaging Het
Dpf2 T C 19: 5,907,012 H16R probably damaging Het
Dsp A G 13: 38,191,619 T1127A probably damaging Het
Dst T C 1: 34,201,123 L1525P probably damaging Het
Ehf T A 2: 103,267,126 D192V probably damaging Het
Frem1 G T 4: 83,020,631 N71K probably damaging Het
Furin T A 7: 80,393,447 T339S probably benign Het
Gad1 T A 2: 70,600,720 I569N possibly damaging Het
Gfi1 T C 5: 107,723,810 K10R probably damaging Het
Gm20775 T A Y: 10,641,258 noncoding transcript Homo
Gpn3 A C 5: 122,378,575 D89A possibly damaging Het
Gpr18 T A 14: 121,911,678 R312* probably null Het
Gsap T C 5: 21,246,971 probably benign Het
H2-Ab1 C A 17: 34,264,809 T48K probably damaging Het
Hmcn2 A T 2: 31,438,285 N4326I probably benign Het
Igkv4-51 A C 6: 69,681,730 probably benign Het
Insr T C 8: 3,161,709 H1104R probably benign Het
Ipo13 A T 4: 117,901,576 N697K probably benign Het
Iqcm T G 8: 75,762,989 F362V probably damaging Het
Irak4 T C 15: 94,566,823 S425P probably damaging Het
Jakmip2 T C 18: 43,577,412 E242G possibly damaging Het
Kdm4a T C 4: 118,144,083 K829R probably damaging Het
Kdr T C 5: 75,968,792 N145S possibly damaging Het
Klra9 A T 6: 130,185,517 D185E probably benign Het
Lcn12 T C 2: 25,493,321 N15S probably benign Het
Mei4 T A 9: 81,927,317 M151K probably damaging Het
Mmp3 T A 9: 7,451,223 S320T probably benign Het
Mrps5 C G 2: 127,590,770 A37G probably benign Het
Mttp A G 3: 138,092,735 I800T possibly damaging Het
Nags A T 11: 102,148,196 Q451L probably damaging Het
Nbea T C 3: 56,058,065 T476A probably damaging Het
Ndufb10 T C 17: 24,722,419 E145G possibly damaging Het
Neb T G 2: 52,304,035 S660R possibly damaging Het
Nppb A G 4: 147,986,296 K43E probably benign Het
Nup188 A T 2: 30,330,633 Q906L probably benign Het
Olfr1259 T C 2: 89,943,869 D82G probably damaging Het
Olfr1413 T C 1: 92,573,330 I53T possibly damaging Het
Olfr370 T A 8: 83,541,860 S239T probably damaging Het
Olfr895 C A 9: 38,269,414 N292K probably damaging Het
Ovch2 T A 7: 107,796,548 I88F possibly damaging Het
Palm3 A G 8: 84,029,935 E692G probably benign Het
Pcsk6 T C 7: 65,983,753 F578L probably damaging Het
Piezo2 A C 18: 63,069,963 D1535E probably damaging Het
Ppp1r15b T C 1: 133,132,135 V130A probably benign Het
Prtg T A 9: 72,890,798 V682E probably damaging Het
Pyroxd1 A T 6: 142,361,868 M455L probably benign Het
Rasa1 T C 13: 85,226,635 D739G possibly damaging Het
Scn3a T C 2: 65,464,730 I1550V possibly damaging Het
Sepsecs T C 5: 52,643,871 D483G probably benign Het
Setd7 T C 3: 51,550,355 D17G probably damaging Het
Sipa1l2 C T 8: 125,491,245 C451Y probably damaging Het
Slc31a1 A G 4: 62,388,702 Y165C probably damaging Het
Smg5 T C 3: 88,342,469 F68L possibly damaging Het
Sptbn5 A G 2: 120,077,208 probably benign Het
Stk3 A G 15: 35,114,565 I65T probably damaging Het
Tas2r115 C T 6: 132,737,284 A235T possibly damaging Het
Tenm2 C T 11: 36,049,097 A1400T probably benign Het
Tet1 T A 10: 62,838,791 N1169Y probably benign Het
Treml2 T A 17: 48,309,397 probably null Het
Tspan11 A G 6: 127,938,235 E104G probably damaging Het
Wdtc1 G A 4: 133,296,431 A543V probably damaging Het
Zfp148 T A 16: 33,496,819 D578E probably damaging Het
Zfp735 A T 11: 73,711,855 N542Y probably damaging Het
Zfp735 A T 11: 73,711,856 N542I probably damaging Het
Zfp869 T A 8: 69,708,143 E65D probably benign Het
Other mutations in Proca1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01806:Proca1 APN 11 78204911 missense probably damaging 0.99
IGL01905:Proca1 APN 11 78204890 missense probably damaging 0.98
R0396:Proca1 UTSW 11 78194905 missense probably damaging 0.96
R0398:Proca1 UTSW 11 78205268 missense probably benign 0.00
R0734:Proca1 UTSW 11 78201802 splice site probably benign
R0980:Proca1 UTSW 11 78204947 missense probably benign 0.00
R1899:Proca1 UTSW 11 78205021 missense probably damaging 0.99
R1900:Proca1 UTSW 11 78205021 missense probably damaging 0.99
R2183:Proca1 UTSW 11 78204149 missense possibly damaging 0.92
R2867:Proca1 UTSW 11 78204980 missense probably damaging 0.97
R2867:Proca1 UTSW 11 78204980 missense probably damaging 0.97
R4237:Proca1 UTSW 11 78204926 missense probably benign 0.22
R5299:Proca1 UTSW 11 78205252 missense probably damaging 0.99
R5318:Proca1 UTSW 11 78201857 missense possibly damaging 0.92
R5379:Proca1 UTSW 11 78205266 missense probably damaging 0.99
R5564:Proca1 UTSW 11 78201873 missense possibly damaging 0.81
R6592:Proca1 UTSW 11 78204953 missense probably benign 0.00
R6796:Proca1 UTSW 11 78194928 missense probably benign
R6894:Proca1 UTSW 11 78194787 unclassified probably benign
R7423:Proca1 UTSW 11 78194817 unclassified probably benign
R8110:Proca1 UTSW 11 78204911 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTTCAACATCATCCATGCC -3'
(R):5'- TGACGTTGCTTTCCTGACAC -3'

Sequencing Primer
(F):5'- GCTTTGAACTCATCCCAGAGG -3'
(R):5'- CACTTTTCTATGGGACTTTCAGAACG -3'
Posted On2015-10-21