Mutagenetix > Incidental Mutation

Incidental Mutation 'R0276:Sipa1l2'

35378

Institutional Source

Beutler Lab

Gene Symbol

Sipa1l2

Ensembl Gene

ENSMUSG00000001995

Gene Name

signal-induced proliferation-associated 1 like 2

Synonyms

MMRRC Submission

038498-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.351) question?

Stock #

R0276 (G1)

Quality Score

163

Status

Validated

Chromosome

Chromosomal Location

125418063-125569808 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 125421940 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1655 (T1655A)

Ref Sequence

ENSEMBL: ENSMUSP00000148536 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000108775] [ENSMUST00000212168] [ENSMUST00000212987]

AlphaFold

Q80TE4

Predicted Effect

probably damaging
Transcript: ENSMUST00000108775
AA Change: T1655A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000104405
Gene: ENSMUSG00000001995
AA Change: T1655A

Domain	Start	End	E-Value	Type
low complexity region	53	64	N/A	INTRINSIC
low complexity region	163	172	N/A	INTRINSIC
low complexity region	261	272	N/A	INTRINSIC
low complexity region	427	449	N/A	INTRINSIC
Pfam:Rap_GAP	625	807	2.6e-67	PFAM
PDZ	960	1026	6.47e-9	SMART
low complexity region	1091	1103	N/A	INTRINSIC
low complexity region	1120	1138	N/A	INTRINSIC
low complexity region	1220	1238	N/A	INTRINSIC
low complexity region	1299	1312	N/A	INTRINSIC
low complexity region	1321	1329	N/A	INTRINSIC
low complexity region	1334	1355	N/A	INTRINSIC
low complexity region	1404	1418	N/A	INTRINSIC
Pfam:SPAR_C	1421	1666	2.5e-76	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000212168
AA Change: T1637A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

Predicted Effect

probably damaging
Transcript: ENSMUST00000212987
AA Change: T1655A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

Meta Mutation Damage Score

0.0615

Coding Region Coverage

1x: 98.7%
3x: 97.8%
10x: 96.2%
20x: 93.8%

Validation Efficiency

98% (101/103)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the signal-induced proliferation-associated 1 like family. Members of this family contain a GTPase activating domain, a PDZ domain and a C-terminal coiled-coil domain with a leucine zipper. A similar protein in rat acts as a GTPases for the small GTPase Rap. [provided by RefSeq, Sep 2015]

Allele List at MGI

Other mutations in this stock

Total: 100 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts13	A	G	2: 26,975,760	N109S	possibly damaging	Het
Adcy10	T	A	1: 165,572,591	M1523K	possibly damaging	Het
Agtpbp1	C	T	13: 59,462,031	S1095N	possibly damaging	Het
Ang2	C	T	14: 51,195,518	V136I	probably damaging	Het
Arhgap10	A	T	8: 77,413,581	M250K	probably benign	Het
Arhgap33	A	T	7: 30,523,244	W1088R	probably benign	Het
Arhgef15	T	C	11: 68,953,472		probably benign	Het
Aspm	T	C	1: 139,478,471	S1699P	possibly damaging	Het
Atp12a	C	A	14: 56,387,694	D1014E	probably damaging	Het
Atp1a4	T	A	1: 172,257,901	K45M	probably damaging	Het
Atp8a1	A	T	5: 67,786,673		probably benign	Het
Baiap3	A	C	17: 25,243,687	F1099C	probably damaging	Het
Bcas3	T	A	11: 85,470,837		probably null	Het
Bms1	G	A	6: 118,408,134	T371M	possibly damaging	Het
Camta1	C	A	4: 151,075,140	R1614L	probably damaging	Het
Capn3	T	C	2: 120,488,065		probably benign	Het
Ccdc180	A	G	4: 45,923,534	D1105G	probably damaging	Het
Ccdc33	G	T	9: 58,058,392	P364Q	probably damaging	Het
Ccdc36	A	T	9: 108,428,440	M11K	possibly damaging	Het
Clstn3	A	G	6: 124,431,740		probably benign	Het
Cntrl	A	T	2: 35,151,732	Y619F	possibly damaging	Het
Col12a1	A	T	9: 79,630,741	Y2514*	probably null	Het
Cpt1b	T	C	15: 89,419,959	H503R	probably benign	Het
Crb1	T	A	1: 139,323,335	T293S	possibly damaging	Het
D130043K22Rik	C	T	13: 24,858,045	T319I	possibly damaging	Het
Dzip1l	G	A	9: 99,660,998	R502Q	probably benign	Het
Efcab5	A	G	11: 77,129,876	M673T	probably damaging	Het
Efcab5	G	A	11: 77,140,923	R42W	probably damaging	Het
F2rl3	A	G	8: 72,762,798	T218A	probably benign	Het
Fam135a	C	T	1: 24,067,964	R31H	probably damaging	Het
Fam84b	G	T	15: 60,823,674	Y74*	probably null	Het
Fcer2a	A	T	8: 3,689,811	N53K	possibly damaging	Het
Gm14085	T	A	2: 122,521,928	S389T	probably damaging	Het
Golgb1	A	C	16: 36,913,876	K1162Q	probably damaging	Het
Gpr137b	A	T	13: 13,367,575		probably benign	Het
Haspin	A	T	11: 73,136,487	L592Q	probably damaging	Het
Helq	A	G	5: 100,790,147	F478L	probably damaging	Het
Il17rb	T	A	14: 30,004,380	T84S	probably damaging	Het
Itga4	T	C	2: 79,321,493	L880P	probably damaging	Het
Itih5	A	G	2: 10,185,564	I61V	possibly damaging	Het
Ivl	G	A	3: 92,571,514	L415F	unknown	Het
Kif2a	A	G	13: 106,976,650		probably benign	Het
Kmt2d	T	C	15: 98,850,311		probably benign	Het
Lars2	A	G	9: 123,438,121		probably benign	Het
Lilrb4a	T	C	10: 51,491,581	V73A	probably benign	Het
Lrrc8a	A	G	2: 30,256,788	D538G	possibly damaging	Het
Lrrk1	G	A	7: 66,296,263		probably benign	Het
Mc2r	A	T	18: 68,408,132	I30K	possibly damaging	Het
Mybbp1a	C	A	11: 72,450,107		probably null	Het
Napg	C	T	18: 62,986,963	R149C	probably damaging	Het
Ncam2	A	G	16: 81,517,629		probably benign	Het
Nlk	T	C	11: 78,571,475	I509V	probably benign	Het
Nlrp2	A	T	7: 5,328,109	N429K	probably benign	Het
Nlrp9b	A	G	7: 20,028,498	T247A	probably benign	Het
Noxo1	A	T	17: 24,700,162		probably null	Het
Olfr1212	T	A	2: 88,958,755	C96*	probably null	Het
Olfr139	A	G	11: 74,045,118	I52T	probably damaging	Het
Olfr353	A	T	2: 36,890,023	M275K	probably benign	Het
Olfr701	A	T	7: 106,818,697	I205L	probably benign	Het
Olfr734	C	A	14: 50,320,179	A219S	probably benign	Het
Oxr1	T	C	15: 41,820,062	S294P	probably damaging	Het
Pfpl	A	G	19: 12,429,237	Y284C	probably damaging	Het
Pi16	A	T	17: 29,326,943	T232S	probably benign	Het
Plcxd2	A	T	16: 46,009,707	N50K	probably benign	Het
Plekhn1	T	A	4: 156,228,246	N52Y	probably damaging	Het
Prl2c5	T	C	13: 13,183,049		probably benign	Het
Prrc2b	G	A	2: 32,219,654	V1080I	probably damaging	Het
Psg28	A	T	7: 18,430,396	N130K	probably benign	Het
Psme4	C	A	11: 30,811,980	T440K	probably damaging	Het
Ptcd2	T	C	13: 99,321,596	K296E	probably benign	Het
Ptprq	T	C	10: 107,542,735		probably null	Het
Rab5b	A	C	10: 128,686,746		probably null	Het
Rft1	T	A	14: 30,690,583	S534T	probably benign	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Rsu1	A	T	2: 13,170,135		probably benign	Het
Senp6	A	G	9: 80,136,747	M887V	probably benign	Het
Sgcz	T	A	8: 37,952,919	M60L	probably benign	Het
Siglec1	G	A	2: 131,083,941	Q282*	probably null	Het
Slc43a3	G	A	2: 84,937,663		probably benign	Het
Snx29	T	C	16: 11,738,373	V756A	probably benign	Het
Spta1	T	A	1: 174,217,894	H1539Q	probably damaging	Het
Stk3	A	C	15: 35,099,469	S104A	probably damaging	Het
Stk38	C	A	17: 28,992,416		probably null	Het
Stx6	T	C	1: 155,174,163		probably benign	Het
Thbs4	G	A	13: 92,775,532	T230I	probably benign	Het
Thrsp	A	G	7: 97,417,502	M1T	probably null	Het
Tmem63b	A	T	17: 45,675,373		probably benign	Het
Top2a	A	G	11: 99,009,907		probably benign	Het
Tpd52l2	T	C	2: 181,502,059		probably null	Het
Trak1	A	G	9: 121,454,338	E390G	probably damaging	Het
Trappc3	T	A	4: 126,273,952	D101E	possibly damaging	Het
Trhr	A	G	15: 44,197,086	M1V	probably null	Het
Triobp	T	A	15: 78,973,676	I1159K	probably benign	Het
Unc45a	A	G	7: 80,326,297		probably benign	Het
Usb1	A	G	8: 95,333,457	D12G	probably damaging	Het
Ushbp1	C	T	8: 71,394,649	C113Y	possibly damaging	Het
Vim	A	G	2: 13,574,859	K143R	probably benign	Het
Vmn2r75	T	C	7: 86,148,307	K766R	probably benign	Het
Wdr92	T	C	11: 17,229,821	I274T	probably benign	Het
Xpo5	T	G	17: 46,241,507	C1089G	probably damaging	Het

Other mutations in Sipa1l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00534:Sipa1l2	APN	8	125491806	missense	probably damaging	1.00
IGL00939:Sipa1l2	APN	8	125464435	splice site	probably benign
IGL00965:Sipa1l2	APN	8	125447874	missense	probably benign	0.02
IGL01321:Sipa1l2	APN	8	125491518	missense	probably damaging	1.00
IGL01450:Sipa1l2	APN	8	125422577	critical splice donor site	probably null
IGL01753:Sipa1l2	APN	8	125453292	splice site	probably benign
IGL01930:Sipa1l2	APN	8	125419239	missense	probably damaging	0.99
IGL02041:Sipa1l2	APN	8	125491819	missense	probably benign	0.03
IGL02215:Sipa1l2	APN	8	125447837	missense	possibly damaging	0.67
IGL02272:Sipa1l2	APN	8	125492011	missense	probably damaging	1.00
IGL02370:Sipa1l2	APN	8	125480269	missense	probably damaging	1.00
IGL02538:Sipa1l2	APN	8	125451977	missense	probably damaging	1.00
IGL02633:Sipa1l2	APN	8	125447768	missense	probably damaging	1.00
IGL03394:Sipa1l2	APN	8	125491659	missense	possibly damaging	0.67
Rebellious	UTSW	8	125468339	missense	probably benign	0.01
R0144:Sipa1l2	UTSW	8	125449876	splice site	probably null
R0153:Sipa1l2	UTSW	8	125421898	missense	probably damaging	0.99
R0318:Sipa1l2	UTSW	8	125447697	missense	possibly damaging	0.73
R0373:Sipa1l2	UTSW	8	125464410	missense	probably damaging	0.99
R0427:Sipa1l2	UTSW	8	125480332	missense	probably damaging	1.00
R0634:Sipa1l2	UTSW	8	125422624	nonsense	probably null
R1377:Sipa1l2	UTSW	8	125491977	missense	probably damaging	1.00
R1404:Sipa1l2	UTSW	8	125449973	missense	probably damaging	1.00
R1404:Sipa1l2	UTSW	8	125449973	missense	probably damaging	1.00
R1435:Sipa1l2	UTSW	8	125468725	missense	probably damaging	1.00
R1523:Sipa1l2	UTSW	8	125447613	missense	possibly damaging	0.75
R1577:Sipa1l2	UTSW	8	125492262	missense	probably benign	0.00
R1581:Sipa1l2	UTSW	8	125491617	missense	probably damaging	0.96
R1583:Sipa1l2	UTSW	8	125421895	missense	probably damaging	0.97
R1719:Sipa1l2	UTSW	8	125444535	missense	probably damaging	0.99
R1730:Sipa1l2	UTSW	8	125480141	splice site	probably null
R1940:Sipa1l2	UTSW	8	125480148	splice site	probably benign
R2007:Sipa1l2	UTSW	8	125439437	missense	probably damaging	1.00
R2141:Sipa1l2	UTSW	8	125491491	missense	probably benign	0.07
R2203:Sipa1l2	UTSW	8	125491627	missense	probably damaging	0.99
R2764:Sipa1l2	UTSW	8	125492374	missense	probably damaging	0.99
R3722:Sipa1l2	UTSW	8	125473584	missense	probably damaging	1.00
R3787:Sipa1l2	UTSW	8	125423205	missense	probably benign
R3787:Sipa1l2	UTSW	8	125450383	missense	possibly damaging	0.52
R4106:Sipa1l2	UTSW	8	125492308	missense	probably damaging	1.00
R4117:Sipa1l2	UTSW	8	125468510	missense	probably damaging	1.00
R4194:Sipa1l2	UTSW	8	125491672	missense	probably benign	0.00
R4237:Sipa1l2	UTSW	8	125491656	missense	probably benign	0.44
R4240:Sipa1l2	UTSW	8	125491656	missense	probably benign	0.44
R4448:Sipa1l2	UTSW	8	125492355	missense	probably damaging	1.00
R4515:Sipa1l2	UTSW	8	125492226	missense	probably benign	0.00
R4519:Sipa1l2	UTSW	8	125492226	missense	probably benign	0.00
R4523:Sipa1l2	UTSW	8	125492424	missense	probably damaging	1.00
R4557:Sipa1l2	UTSW	8	125464415	missense	probably damaging	0.98
R4667:Sipa1l2	UTSW	8	125453470	missense	possibly damaging	0.93
R4687:Sipa1l2	UTSW	8	125491245	missense	probably damaging	1.00
R4854:Sipa1l2	UTSW	8	125473601	missense	probably damaging	1.00
R4890:Sipa1l2	UTSW	8	125491867	missense	probably damaging	1.00
R5065:Sipa1l2	UTSW	8	125491585	missense	probably benign	0.19
R5194:Sipa1l2	UTSW	8	125439273	missense	possibly damaging	0.48
R5266:Sipa1l2	UTSW	8	125492126	missense	probably damaging	0.99
R5475:Sipa1l2	UTSW	8	125491595	missense	probably damaging	1.00
R5718:Sipa1l2	UTSW	8	125491248	missense	probably damaging	1.00
R5910:Sipa1l2	UTSW	8	125491684	missense	probably benign	0.42
R5916:Sipa1l2	UTSW	8	125468573	missense	probably damaging	1.00
R5941:Sipa1l2	UTSW	8	125473536	missense	probably damaging	0.99
R6083:Sipa1l2	UTSW	8	125468473	missense	possibly damaging	0.87
R6185:Sipa1l2	UTSW	8	125468253	nonsense	probably null
R6235:Sipa1l2	UTSW	8	125474871	missense	probably damaging	1.00
R6274:Sipa1l2	UTSW	8	125469872	missense	probably damaging	1.00
R6299:Sipa1l2	UTSW	8	125453464	missense	possibly damaging	0.75
R6374:Sipa1l2	UTSW	8	125444630	missense	probably damaging	1.00
R6459:Sipa1l2	UTSW	8	125444484	critical splice donor site	probably null
R6462:Sipa1l2	UTSW	8	125491230	missense	probably damaging	1.00
R6496:Sipa1l2	UTSW	8	125449894	missense	probably benign	0.00
R6543:Sipa1l2	UTSW	8	125450362	missense	possibly damaging	0.50
R7154:Sipa1l2	UTSW	8	125468339	missense	probably benign	0.01
R7192:Sipa1l2	UTSW	8	125422609	missense	probably benign	0.09
R7240:Sipa1l2	UTSW	8	125469860	missense	probably damaging	1.00
R7361:Sipa1l2	UTSW	8	125453332	missense	probably damaging	1.00
R7383:Sipa1l2	UTSW	8	125447646	missense	probably damaging	1.00
R7417:Sipa1l2	UTSW	8	125482106	missense	possibly damaging	0.93
R7604:Sipa1l2	UTSW	8	125419272	missense	probably benign	0.45
R7658:Sipa1l2	UTSW	8	125492290	missense	probably benign	0.00
R7743:Sipa1l2	UTSW	8	125464233	missense	probably damaging	1.00
R7781:Sipa1l2	UTSW	8	125491827	missense	possibly damaging	0.46
R7812:Sipa1l2	UTSW	8	125491595	missense	probably damaging	1.00
R7829:Sipa1l2	UTSW	8	125451988	missense	probably damaging	1.00
R7880:Sipa1l2	UTSW	8	125464393	missense	probably damaging	1.00
R7884:Sipa1l2	UTSW	8	125447598	missense	probably benign
R8057:Sipa1l2	UTSW	8	125468530	missense	probably damaging	1.00
R8082:Sipa1l2	UTSW	8	125491809	missense	possibly damaging	0.82
R8092:Sipa1l2	UTSW	8	125419168	missense	probably benign	0.03
R8247:Sipa1l2	UTSW	8	125422633	missense	probably benign	0.29
R8252:Sipa1l2	UTSW	8	125468671	missense	probably damaging	1.00
R8386:Sipa1l2	UTSW	8	125492093	missense	probably damaging	1.00
R8466:Sipa1l2	UTSW	8	125492246	missense	probably damaging	1.00
R8697:Sipa1l2	UTSW	8	125482116	missense	probably damaging	1.00
R8725:Sipa1l2	UTSW	8	125450386	missense	probably benign	0.28
R8727:Sipa1l2	UTSW	8	125450386	missense	probably benign	0.28
R9048:Sipa1l2	UTSW	8	125447726	missense	possibly damaging	0.59
R9224:Sipa1l2	UTSW	8	125491977	missense	probably damaging	1.00
R9279:Sipa1l2	UTSW	8	125482157	missense	probably damaging	1.00
R9392:Sipa1l2	UTSW	8	125468221	missense	probably benign
R9574:Sipa1l2	UTSW	8	125442714	missense	probably benign
R9591:Sipa1l2	UTSW	8	125492373	missense	probably damaging	0.99
R9614:Sipa1l2	UTSW	8	125469826	missense	probably null	0.01
R9690:Sipa1l2	UTSW	8	125492257	missense	probably benign
X0027:Sipa1l2	UTSW	8	125492136	missense	probably damaging	1.00
Z1177:Sipa1l2	UTSW	8	125447556	missense	possibly damaging	0.72

Predicted Primers

PCR Primer
(F):5'- TGTGAGAGCTGACTGACTGACTGAC -3'
(R):5'- AACTTGCTGGGGAACCTGGTTCTG -3'

Sequencing Primer
(F):5'- gactgactgactgactgactg -3'
(R):5'- GGTTCTGTCTTCAGGACAAAAGC -3'

Posted On

2013-05-09