Incidental Mutation 'R4687:Amn'
ID 353782
Institutional Source Beutler Lab
Gene Symbol Amn
Ensembl Gene ENSMUSG00000021278
Gene Name amnionless
Synonyms
MMRRC Submission 041938-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4687 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 111271095-111276426 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 111276068 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 439 (D439V)
Ref Sequence ENSEMBL: ENSMUSP00000021707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021707]
AlphaFold Q99JB7
Predicted Effect probably benign
Transcript: ENSMUST00000021707
AA Change: D439V

PolyPhen 2 Score 0.353 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000021707
Gene: ENSMUSG00000021278
AA Change: D439V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Amnionless 21 451 6.4e-142 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220551
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220903
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a type I transmembrane protein. The encoded protein is an essential component of the cubulin receptor complex which is thought to play a role in coordinating growth and patterning of the embryo. This protein is thought to modulate a bone morphogenetic protein (BMP) signaling pathway. A homoygous mutation in the mouse gene results in the lack of an amnion in embryos. Mutations in the human gene are associated with Megaloblastic Anemia-1. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous mutation of this gene results in embryonic growth arrest between the mid and late streak stages of gastrulation and abnormal ectoderm formation, followed by death. Generation of middle primitive streak derivatives is impaired, leading to absence of mesoderm and somites. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T A 17: 8,992,153 Y45N probably damaging Het
Agbl3 T C 6: 34,798,326 V189A probably damaging Het
Akip1 C A 7: 109,704,986 S90* probably null Het
Arhgap17 T A 7: 123,321,603 D149V probably damaging Het
Atp6v0a4 A T 6: 38,092,465 I76N possibly damaging Het
Atp6v1h A T 1: 5,133,085 N291I probably damaging Het
Baiap2l2 G T 15: 79,259,253 P462T probably damaging Het
Bves C T 10: 45,354,840 probably null Het
Cabp7 T A 11: 4,739,265 K127* probably null Het
Cacna1h A G 17: 25,393,910 V313A possibly damaging Het
Camkk2 T C 5: 122,753,724 H245R probably damaging Het
Celsr1 T A 15: 85,932,460 S1761C possibly damaging Het
Cfap46 T C 7: 139,627,456 E1849G possibly damaging Het
Ciz1 T C 2: 32,367,465 L174P probably damaging Het
Crim1 G T 17: 78,303,025 C303F probably damaging Het
Cyp26c1 A G 19: 37,692,937 Q396R probably damaging Het
Dnajc7 G A 11: 100,599,300 P43L probably damaging Het
Dpf2 T C 19: 5,907,012 H16R probably damaging Het
Dsp A G 13: 38,191,619 T1127A probably damaging Het
Dst T C 1: 34,201,123 L1525P probably damaging Het
Ehf T A 2: 103,267,126 D192V probably damaging Het
Frem1 G T 4: 83,020,631 N71K probably damaging Het
Furin T A 7: 80,393,447 T339S probably benign Het
Gad1 T A 2: 70,600,720 I569N possibly damaging Het
Gfi1 T C 5: 107,723,810 K10R probably damaging Het
Gm20775 T A Y: 10,641,258 noncoding transcript Homo
Gpn3 A C 5: 122,378,575 D89A possibly damaging Het
Gpr18 T A 14: 121,911,678 R312* probably null Het
Gsap T C 5: 21,246,971 probably benign Het
H2-Ab1 C A 17: 34,264,809 T48K probably damaging Het
Hmcn2 A T 2: 31,438,285 N4326I probably benign Het
Igkv4-51 A C 6: 69,681,730 probably benign Het
Insr T C 8: 3,161,709 H1104R probably benign Het
Ipo13 A T 4: 117,901,576 N697K probably benign Het
Iqcm T G 8: 75,762,989 F362V probably damaging Het
Irak4 T C 15: 94,566,823 S425P probably damaging Het
Jakmip2 T C 18: 43,577,412 E242G possibly damaging Het
Kdm4a T C 4: 118,144,083 K829R probably damaging Het
Kdr T C 5: 75,968,792 N145S possibly damaging Het
Klra9 A T 6: 130,185,517 D185E probably benign Het
Lcn12 T C 2: 25,493,321 N15S probably benign Het
Mei4 T A 9: 81,927,317 M151K probably damaging Het
Mmp3 T A 9: 7,451,223 S320T probably benign Het
Mrps5 C G 2: 127,590,770 A37G probably benign Het
Mttp A G 3: 138,092,735 I800T possibly damaging Het
Nags A T 11: 102,148,196 Q451L probably damaging Het
Nbea T C 3: 56,058,065 T476A probably damaging Het
Ndufb10 T C 17: 24,722,419 E145G possibly damaging Het
Neb T G 2: 52,304,035 S660R possibly damaging Het
Nppb A G 4: 147,986,296 K43E probably benign Het
Nup188 A T 2: 30,330,633 Q906L probably benign Het
Olfr1259 T C 2: 89,943,869 D82G probably damaging Het
Olfr1413 T C 1: 92,573,330 I53T possibly damaging Het
Olfr370 T A 8: 83,541,860 S239T probably damaging Het
Olfr895 C A 9: 38,269,414 N292K probably damaging Het
Ovch2 T A 7: 107,796,548 I88F possibly damaging Het
Palm3 A G 8: 84,029,935 E692G probably benign Het
Pcsk6 T C 7: 65,983,753 F578L probably damaging Het
Piezo2 A C 18: 63,069,963 D1535E probably damaging Het
Ppp1r15b T C 1: 133,132,135 V130A probably benign Het
Proca1 T C 11: 78,204,898 Y32H probably damaging Het
Prtg T A 9: 72,890,798 V682E probably damaging Het
Pyroxd1 A T 6: 142,361,868 M455L probably benign Het
Rasa1 T C 13: 85,226,635 D739G possibly damaging Het
Scn3a T C 2: 65,464,730 I1550V possibly damaging Het
Sepsecs T C 5: 52,643,871 D483G probably benign Het
Setd7 T C 3: 51,550,355 D17G probably damaging Het
Sipa1l2 C T 8: 125,491,245 C451Y probably damaging Het
Slc31a1 A G 4: 62,388,702 Y165C probably damaging Het
Smg5 T C 3: 88,342,469 F68L possibly damaging Het
Sptbn5 A G 2: 120,077,208 probably benign Het
Stk3 A G 15: 35,114,565 I65T probably damaging Het
Tas2r115 C T 6: 132,737,284 A235T possibly damaging Het
Tenm2 C T 11: 36,049,097 A1400T probably benign Het
Tet1 T A 10: 62,838,791 N1169Y probably benign Het
Treml2 T A 17: 48,309,397 probably null Het
Tspan11 A G 6: 127,938,235 E104G probably damaging Het
Wdtc1 G A 4: 133,296,431 A543V probably damaging Het
Zfp148 T A 16: 33,496,819 D578E probably damaging Het
Zfp735 A T 11: 73,711,855 N542Y probably damaging Het
Zfp735 A T 11: 73,711,856 N542I probably damaging Het
Zfp869 T A 8: 69,708,143 E65D probably benign Het
Other mutations in Amn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01479:Amn APN 12 111271793 missense probably damaging 0.97
IGL02397:Amn APN 12 111274479 missense possibly damaging 0.77
IGL02962:Amn APN 12 111274517 missense probably damaging 1.00
IGL02974:Amn APN 12 111271141 missense probably benign 0.01
IGL02837:Amn UTSW 12 111271899 missense possibly damaging 0.74
R0357:Amn UTSW 12 111274141 critical splice acceptor site probably null
R1986:Amn UTSW 12 111274997 missense probably damaging 1.00
R1993:Amn UTSW 12 111276092 missense probably damaging 1.00
R2355:Amn UTSW 12 111271812 missense probably damaging 0.99
R3924:Amn UTSW 12 111275680 missense possibly damaging 0.71
R3925:Amn UTSW 12 111275680 missense possibly damaging 0.71
R4364:Amn UTSW 12 111271762 missense probably damaging 0.99
R6176:Amn UTSW 12 111274156 missense possibly damaging 0.55
R6209:Amn UTSW 12 111275411 missense probably damaging 0.99
R6300:Amn UTSW 12 111274189 missense probably benign 0.16
R6591:Amn UTSW 12 111275397 missense possibly damaging 0.77
R6691:Amn UTSW 12 111275397 missense possibly damaging 0.77
R8475:Amn UTSW 12 111275385 missense probably benign 0.02
R8747:Amn UTSW 12 111275006 missense probably damaging 1.00
R9262:Amn UTSW 12 111271151 nonsense probably null
X0025:Amn UTSW 12 111275399 missense probably damaging 1.00
Z1088:Amn UTSW 12 111275683 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- GGGTTTCCGAAATCCGATTTTC -3'
(R):5'- GGTTACAAGTAGGACCAGGCTATC -3'

Sequencing Primer
(F):5'- GAAATCCGATTTTCGACGCG -3'
(R):5'- AAACAAACAAGCAACTCTTTATTGGG -3'
Posted On 2015-10-21