Mutagenetix > Incidental Mutation

Incidental Mutation 'R4687:Dsp'

353783

Institutional Source

Beutler Lab

Gene Symbol

Dsp

Ensembl Gene

ENSMUSG00000054889

Gene Name

desmoplakin

Synonyms

5730453H04Rik, DP, 2300002E22Rik

MMRRC Submission

041938-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4687 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

38151294-38198577 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 38191619 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1127 (T1127A)

Ref Sequence

ENSEMBL: ENSMUSP00000115062 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000124830] [ENSMUST00000127906]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000124830
AA Change: T1127A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000115062
Gene: ENSMUSG00000054889
AA Change: T1127A

Domain	Start	End	E-Value	Type
Blast:SPEC	193	282	2e-51	BLAST
SPEC	285	385	6.03e-2	SMART
Blast:SPEC	391	557	1e-96	BLAST
Blast:SPEC	783	894	4e-34	BLAST
SPEC	901	1030	1.39e0	SMART
coiled coil region	1033	1370	N/A	INTRINSIC
coiled coil region	1394	1956	N/A	INTRINSIC
low complexity region	1997	2011	N/A	INTRINSIC
PLEC	2021	2057	3.33e-1	SMART
PLEC	2058	2095	3.76e-9	SMART
PLEC	2096	2133	4.09e-10	SMART
PLEC	2134	2171	2.09e-7	SMART
PLEC	2175	2209	4.83e1	SMART
PLEC	2210	2245	5.67e1	SMART
PLEC	2263	2300	1.22e-8	SMART
PLEC	2301	2338	1.16e-9	SMART
PLEC	2339	2376	1.12e-7	SMART
PLEC	2377	2414	1.56e-6	SMART
PLEC	2418	2452	1.42e0	SMART
PLEC	2468	2505	3.7e-8	SMART
low complexity region	2507	2517	N/A	INTRINSIC
PLEC	2519	2556	3.73e-4	SMART
low complexity region	2577	2593	N/A	INTRINSIC
PLEC	2622	2659	1.46e-6	SMART
PLEC	2660	2697	6.69e-15	SMART
PLEC	2698	2735	1.98e2	SMART
PLEC	2736	2773	2.35e-10	SMART
PLEC	2774	2811	1.39e-3	SMART
low complexity region	2835	2860	N/A	INTRINSIC
low complexity region	2867	2879	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000127906
AA Change: T1127A

PolyPhen 2 Score 0.593 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000117252
Gene: ENSMUSG00000054889
AA Change: T1127A

Domain	Start	End	E-Value	Type
Blast:SPEC	193	282	2e-51	BLAST
SPEC	285	385	6.03e-2	SMART
Blast:SPEC	391	557	1e-95	BLAST
Blast:SPEC	783	894	3e-34	BLAST
SPEC	901	1030	1.39e0	SMART
coiled coil region	1033	1357	N/A	INTRINSIC
low complexity region	1398	1412	N/A	INTRINSIC
PLEC	1422	1458	3.33e-1	SMART
PLEC	1459	1496	3.76e-9	SMART
PLEC	1497	1534	4.09e-10	SMART
PLEC	1535	1572	2.09e-7	SMART
PLEC	1576	1610	4.83e1	SMART
PLEC	1611	1646	5.67e1	SMART
PLEC	1664	1701	1.22e-8	SMART
PLEC	1702	1739	1.16e-9	SMART
PLEC	1740	1777	1.12e-7	SMART
PLEC	1778	1815	1.56e-6	SMART
PLEC	1819	1853	1.42e0	SMART
PLEC	1869	1906	3.7e-8	SMART
low complexity region	1908	1918	N/A	INTRINSIC
PLEC	1920	1957	3.73e-4	SMART
low complexity region	1978	1994	N/A	INTRINSIC
PLEC	2023	2060	1.46e-6	SMART
PLEC	2061	2098	6.69e-15	SMART
PLEC	2099	2136	1.98e2	SMART
PLEC	2137	2174	2.35e-10	SMART
PLEC	2175	2212	1.39e-3	SMART
low complexity region	2236	2261	N/A	INTRINSIC
low complexity region	2268	2280	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that anchors intermediate filaments to desmosomal plaques and forms an obligate component of functional desmosomes. Mutations in this gene are the cause of several cardiomyopathies and keratodermas, including skin fragility-woolly hair syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous targeted null mutants die by embryonic day E6.5 due to instability of desmosomes and tissue integrity; rescue by aggregation with wild-type tetraploid morulae increase embyronic survival with noted major defects in heart muscle, neuroepithelium and epidermis; conditional knockouts that are epidermal-specific have compositionally altered epidermal desmosomes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700010I14Rik	T	A	17: 8,992,153	Y45N	probably damaging	Het
Agbl3	T	C	6: 34,798,326	V189A	probably damaging	Het
Akip1	C	A	7: 109,704,986	S90*	probably null	Het
Amn	A	T	12: 111,276,068	D439V	probably benign	Het
Arhgap17	T	A	7: 123,321,603	D149V	probably damaging	Het
Atp6v0a4	A	T	6: 38,092,465	I76N	possibly damaging	Het
Atp6v1h	A	T	1: 5,133,085	N291I	probably damaging	Het
Baiap2l2	G	T	15: 79,259,253	P462T	probably damaging	Het
Bves	C	T	10: 45,354,840		probably null	Het
Cabp7	T	A	11: 4,739,265	K127*	probably null	Het
Cacna1h	A	G	17: 25,393,910	V313A	possibly damaging	Het
Camkk2	T	C	5: 122,753,724	H245R	probably damaging	Het
Celsr1	T	A	15: 85,932,460	S1761C	possibly damaging	Het
Cfap46	T	C	7: 139,627,456	E1849G	possibly damaging	Het
Ciz1	T	C	2: 32,367,465	L174P	probably damaging	Het
Crim1	G	T	17: 78,303,025	C303F	probably damaging	Het
Cyp26c1	A	G	19: 37,692,937	Q396R	probably damaging	Het
Dnajc7	G	A	11: 100,599,300	P43L	probably damaging	Het
Dpf2	T	C	19: 5,907,012	H16R	probably damaging	Het
Dst	T	C	1: 34,201,123	L1525P	probably damaging	Het
Ehf	T	A	2: 103,267,126	D192V	probably damaging	Het
Frem1	G	T	4: 83,020,631	N71K	probably damaging	Het
Furin	T	A	7: 80,393,447	T339S	probably benign	Het
Gad1	T	A	2: 70,600,720	I569N	possibly damaging	Het
Gfi1	T	C	5: 107,723,810	K10R	probably damaging	Het
Gm20775	T	A	Y: 10,641,258		noncoding transcript	Homo
Gpn3	A	C	5: 122,378,575	D89A	possibly damaging	Het
Gpr18	T	A	14: 121,911,678	R312*	probably null	Het
Gsap	T	C	5: 21,246,971		probably benign	Het
H2-Ab1	C	A	17: 34,264,809	T48K	probably damaging	Het
Hmcn2	A	T	2: 31,438,285	N4326I	probably benign	Het
Igkv4-51	A	C	6: 69,681,730		probably benign	Het
Insr	T	C	8: 3,161,709	H1104R	probably benign	Het
Ipo13	A	T	4: 117,901,576	N697K	probably benign	Het
Iqcm	T	G	8: 75,762,989	F362V	probably damaging	Het
Irak4	T	C	15: 94,566,823	S425P	probably damaging	Het
Jakmip2	T	C	18: 43,577,412	E242G	possibly damaging	Het
Kdm4a	T	C	4: 118,144,083	K829R	probably damaging	Het
Kdr	T	C	5: 75,968,792	N145S	possibly damaging	Het
Klra9	A	T	6: 130,185,517	D185E	probably benign	Het
Lcn12	T	C	2: 25,493,321	N15S	probably benign	Het
Mei4	T	A	9: 81,927,317	M151K	probably damaging	Het
Mmp3	T	A	9: 7,451,223	S320T	probably benign	Het
Mrps5	C	G	2: 127,590,770	A37G	probably benign	Het
Mttp	A	G	3: 138,092,735	I800T	possibly damaging	Het
Nags	A	T	11: 102,148,196	Q451L	probably damaging	Het
Nbea	T	C	3: 56,058,065	T476A	probably damaging	Het
Ndufb10	T	C	17: 24,722,419	E145G	possibly damaging	Het
Neb	T	G	2: 52,304,035	S660R	possibly damaging	Het
Nppb	A	G	4: 147,986,296	K43E	probably benign	Het
Nup188	A	T	2: 30,330,633	Q906L	probably benign	Het
Olfr1259	T	C	2: 89,943,869	D82G	probably damaging	Het
Olfr1413	T	C	1: 92,573,330	I53T	possibly damaging	Het
Olfr370	T	A	8: 83,541,860	S239T	probably damaging	Het
Olfr895	C	A	9: 38,269,414	N292K	probably damaging	Het
Ovch2	T	A	7: 107,796,548	I88F	possibly damaging	Het
Palm3	A	G	8: 84,029,935	E692G	probably benign	Het
Pcsk6	T	C	7: 65,983,753	F578L	probably damaging	Het
Piezo2	A	C	18: 63,069,963	D1535E	probably damaging	Het
Ppp1r15b	T	C	1: 133,132,135	V130A	probably benign	Het
Proca1	T	C	11: 78,204,898	Y32H	probably damaging	Het
Prtg	T	A	9: 72,890,798	V682E	probably damaging	Het
Pyroxd1	A	T	6: 142,361,868	M455L	probably benign	Het
Rasa1	T	C	13: 85,226,635	D739G	possibly damaging	Het
Scn3a	T	C	2: 65,464,730	I1550V	possibly damaging	Het
Sepsecs	T	C	5: 52,643,871	D483G	probably benign	Het
Setd7	T	C	3: 51,550,355	D17G	probably damaging	Het
Sipa1l2	C	T	8: 125,491,245	C451Y	probably damaging	Het
Slc31a1	A	G	4: 62,388,702	Y165C	probably damaging	Het
Smg5	T	C	3: 88,342,469	F68L	possibly damaging	Het
Sptbn5	A	G	2: 120,077,208		probably benign	Het
Stk3	A	G	15: 35,114,565	I65T	probably damaging	Het
Tas2r115	C	T	6: 132,737,284	A235T	possibly damaging	Het
Tenm2	C	T	11: 36,049,097	A1400T	probably benign	Het
Tet1	T	A	10: 62,838,791	N1169Y	probably benign	Het
Treml2	T	A	17: 48,309,397		probably null	Het
Tspan11	A	G	6: 127,938,235	E104G	probably damaging	Het
Wdtc1	G	A	4: 133,296,431	A543V	probably damaging	Het
Zfp148	T	A	16: 33,496,819	D578E	probably damaging	Het
Zfp735	A	T	11: 73,711,855	N542Y	probably damaging	Het
Zfp735	A	T	11: 73,711,856	N542I	probably damaging	Het
Zfp869	T	A	8: 69,708,143	E65D	probably benign	Het

Other mutations in Dsp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00502:Dsp	APN	13	38197846	missense	probably damaging	0.99
IGL01337:Dsp	APN	13	38192687	missense	probably benign	0.44
IGL01371:Dsp	APN	13	38193617	missense	probably benign	0.13
IGL01473:Dsp	APN	13	38167571	missense	probably damaging	0.99
IGL01660:Dsp	APN	13	38176495	missense	possibly damaging	0.90
IGL01723:Dsp	APN	13	38179084	missense	probably damaging	1.00
IGL01999:Dsp	APN	13	38181186	missense	probably damaging	0.99
IGL02313:Dsp	APN	13	38196523	nonsense	probably null
IGL02833:Dsp	APN	13	38192921	missense	possibly damaging	0.56
IGL03050:Dsp	APN	13	38188445	splice site	probably benign
IGL03353:Dsp	APN	13	38186695	missense	probably damaging	1.00
R0052:Dsp	UTSW	13	38197364	missense	possibly damaging	0.93
R0052:Dsp	UTSW	13	38197364	missense	possibly damaging	0.93
R0078:Dsp	UTSW	13	38196017	missense	probably benign	0.22
R0230:Dsp	UTSW	13	38197705	missense	probably benign	0.03
R0234:Dsp	UTSW	13	38187893	missense	probably benign	0.13
R0234:Dsp	UTSW	13	38187893	missense	probably benign	0.13
R0285:Dsp	UTSW	13	38172794	missense	probably benign
R0326:Dsp	UTSW	13	38192870	nonsense	probably null
R0332:Dsp	UTSW	13	38182228	nonsense	probably null
R0471:Dsp	UTSW	13	38193350	nonsense	probably null
R0567:Dsp	UTSW	13	38192438	missense	probably benign	0.01
R0611:Dsp	UTSW	13	38187741	missense	probably damaging	1.00
R0718:Dsp	UTSW	13	38196764	missense	possibly damaging	0.80
R0926:Dsp	UTSW	13	38183218	missense	probably damaging	0.97
R1078:Dsp	UTSW	13	38183106	splice site	probably benign
R1183:Dsp	UTSW	13	38191740	nonsense	probably null
R1188:Dsp	UTSW	13	38194963	missense	probably damaging	1.00
R1419:Dsp	UTSW	13	38186695	missense	probably damaging	1.00
R1445:Dsp	UTSW	13	38191931	missense	probably damaging	0.98
R1467:Dsp	UTSW	13	38192712	missense	probably benign	0.00
R1467:Dsp	UTSW	13	38192712	missense	probably benign	0.00
R1478:Dsp	UTSW	13	38181138	missense	probably damaging	1.00
R1568:Dsp	UTSW	13	38175147	missense	probably damaging	1.00
R1572:Dsp	UTSW	13	38195738	missense	probably damaging	1.00
R1676:Dsp	UTSW	13	38193374	nonsense	probably null
R1736:Dsp	UTSW	13	38192990	missense	probably benign	0.01
R1776:Dsp	UTSW	13	38196617	missense	probably damaging	0.99
R1829:Dsp	UTSW	13	38193195	missense	probably damaging	1.00
R1878:Dsp	UTSW	13	38164855	missense	possibly damaging	0.53
R2013:Dsp	UTSW	13	38191458	missense	probably damaging	1.00
R2161:Dsp	UTSW	13	38196451	missense	probably damaging	1.00
R2187:Dsp	UTSW	13	38176407	missense	probably damaging	1.00
R2295:Dsp	UTSW	13	38197046	missense	probably benign	0.28
R2495:Dsp	UTSW	13	38193477	missense	possibly damaging	0.91
R2566:Dsp	UTSW	13	38196404	missense	probably damaging	1.00
R2888:Dsp	UTSW	13	38192248	missense	possibly damaging	0.92
R3012:Dsp	UTSW	13	38193342	missense	possibly damaging	0.61
R3614:Dsp	UTSW	13	38177199	missense	probably damaging	0.98
R3725:Dsp	UTSW	13	38194689	splice site	probably null
R3725:Dsp	UTSW	13	38197618	missense	probably benign	0.00
R3797:Dsp	UTSW	13	38177284	critical splice donor site	probably null
R3841:Dsp	UTSW	13	38197705	missense	probably benign
R4030:Dsp	UTSW	13	38191428	missense	possibly damaging	0.84
R4124:Dsp	UTSW	13	38186713	missense	probably damaging	1.00
R4279:Dsp	UTSW	13	38185231	missense	probably damaging	1.00
R4334:Dsp	UTSW	13	38196664	missense	possibly damaging	0.46
R4419:Dsp	UTSW	13	38195132	missense	probably damaging	1.00
R4615:Dsp	UTSW	13	38191632	missense	probably damaging	0.98
R4627:Dsp	UTSW	13	38168641	missense	probably benign	0.01
R4639:Dsp	UTSW	13	38196784	missense	probably damaging	1.00
R4735:Dsp	UTSW	13	38196040	missense	probably damaging	0.99
R4746:Dsp	UTSW	13	38195104	missense	possibly damaging	0.51
R4772:Dsp	UTSW	13	38167528	nonsense	probably null
R4830:Dsp	UTSW	13	38192864	missense	probably benign
R4850:Dsp	UTSW	13	38192469	missense	probably damaging	1.00
R4959:Dsp	UTSW	13	38191710	missense	probably benign	0.41
R4963:Dsp	UTSW	13	38197870	missense	probably damaging	0.99
R4969:Dsp	UTSW	13	38192910	missense	probably benign	0.00
R4978:Dsp	UTSW	13	38182234	missense	probably damaging	1.00
R4989:Dsp	UTSW	13	38197702	missense	possibly damaging	0.93
R5068:Dsp	UTSW	13	38197123	missense	possibly damaging	0.78
R5069:Dsp	UTSW	13	38197123	missense	possibly damaging	0.78
R5070:Dsp	UTSW	13	38197123	missense	possibly damaging	0.78
R5133:Dsp	UTSW	13	38197702	missense	possibly damaging	0.93
R5138:Dsp	UTSW	13	38183298	missense	probably benign	0.37
R5138:Dsp	UTSW	13	38195845	missense	possibly damaging	0.50
R5153:Dsp	UTSW	13	38182306	missense	probably damaging	1.00
R5199:Dsp	UTSW	13	38192902	nonsense	probably null
R5226:Dsp	UTSW	13	38186770	missense	probably damaging	0.99
R5265:Dsp	UTSW	13	38195183	missense	possibly damaging	0.95
R5371:Dsp	UTSW	13	38194889	missense	probably damaging	0.97
R5484:Dsp	UTSW	13	38184038	missense	possibly damaging	0.48
R5534:Dsp	UTSW	13	38195842	missense	probably benign	0.01
R5569:Dsp	UTSW	13	38192652	missense	probably benign	0.01
R5854:Dsp	UTSW	13	38167501	splice site	probably null
R5910:Dsp	UTSW	13	38192469	missense	possibly damaging	0.95
R5929:Dsp	UTSW	13	38195434	missense	possibly damaging	0.92
R5940:Dsp	UTSW	13	38196026	missense	possibly damaging	0.70
R5948:Dsp	UTSW	13	38195401	missense	possibly damaging	0.95
R5955:Dsp	UTSW	13	38194958	missense	possibly damaging	0.73
R5970:Dsp	UTSW	13	38195702	missense	possibly damaging	0.93
R6054:Dsp	UTSW	13	38167609	missense	probably benign	0.00
R6113:Dsp	UTSW	13	38192047	missense	probably damaging	1.00
R6139:Dsp	UTSW	13	38192406	missense	probably damaging	0.97
R6328:Dsp	UTSW	13	38197006	nonsense	probably null
R6527:Dsp	UTSW	13	38195873	missense	probably damaging	1.00
R6573:Dsp	UTSW	13	38196862	missense	probably damaging	1.00
R6628:Dsp	UTSW	13	38167622	missense	possibly damaging	0.73
R6738:Dsp	UTSW	13	38192210	missense	possibly damaging	0.87
R6898:Dsp	UTSW	13	38192217	missense	possibly damaging	0.59
R6919:Dsp	UTSW	13	38167655	missense	possibly damaging	0.84
R6951:Dsp	UTSW	13	38167646	missense	possibly damaging	0.95
R7017:Dsp	UTSW	13	38186707	missense	probably benign	0.02
R7022:Dsp	UTSW	13	38191740	missense	probably benign	0.06
R7135:Dsp	UTSW	13	38179073	missense	probably damaging	1.00
R7192:Dsp	UTSW	13	38195593	missense	probably benign	0.09
R7211:Dsp	UTSW	13	38188535	critical splice donor site	probably null
R7251:Dsp	UTSW	13	38193548	missense	probably benign	0.02
R7326:Dsp	UTSW	13	38192883	missense	probably benign	0.01
R7369:Dsp	UTSW	13	38197525	missense	possibly damaging	0.82
R7376:Dsp	UTSW	13	38172843	missense	probably damaging	1.00
R7406:Dsp	UTSW	13	38197196	missense	possibly damaging	0.63
R7439:Dsp	UTSW	13	38176502	critical splice donor site	probably null
R7439:Dsp	UTSW	13	38195449	missense	probably benign	0.00
R7441:Dsp	UTSW	13	38195449	missense	probably benign	0.00
R7477:Dsp	UTSW	13	38172863	missense	probably damaging	1.00
R7535:Dsp	UTSW	13	38192789	missense	probably benign	0.05
R7558:Dsp	UTSW	13	38168766	missense	probably benign	0.02
R7600:Dsp	UTSW	13	38191715	missense	probably damaging	1.00
R7616:Dsp	UTSW	13	38191482	missense	probably damaging	0.98
R7702:Dsp	UTSW	13	38175207	missense	possibly damaging	0.83
R7738:Dsp	UTSW	13	38185175	missense	probably damaging	0.97
R7815:Dsp	UTSW	13	38191470	missense	probably benign	0.31
R7882:Dsp	UTSW	13	38184018	missense	possibly damaging	0.76
R7917:Dsp	UTSW	13	38167639	nonsense	probably null
R7971:Dsp	UTSW	13	38192523	missense	probably damaging	0.97
R8104:Dsp	UTSW	13	38168624	missense	probably benign	0.03
R8176:Dsp	UTSW	13	38192810	missense	possibly damaging	0.56
R8303:Dsp	UTSW	13	38197343	missense	probably benign
R8323:Dsp	UTSW	13	38172830	missense	possibly damaging	0.80
R8326:Dsp	UTSW	13	38191635	missense	probably damaging	1.00
R8358:Dsp	UTSW	13	38192481	missense	possibly damaging	0.92
R8410:Dsp	UTSW	13	38196815	missense	possibly damaging	0.94
R8552:Dsp	UTSW	13	38185141	missense	probably damaging	0.98
R8713:Dsp	UTSW	13	38168725	missense	probably damaging	0.99
R8801:Dsp	UTSW	13	38197526	missense	possibly damaging	0.81
R8900:Dsp	UTSW	13	38181179	missense	probably damaging	0.99
R8901:Dsp	UTSW	13	38181179	missense	probably damaging	0.99
R8968:Dsp	UTSW	13	38151620	missense	possibly damaging	0.83
R9014:Dsp	UTSW	13	38192724	missense	possibly damaging	0.83
R9021:Dsp	UTSW	13	38196832	missense	possibly damaging	0.61
R9030:Dsp	UTSW	13	38168697	missense	probably damaging	1.00
R9124:Dsp	UTSW	13	38193300	missense	probably benign	0.42
R9129:Dsp	UTSW	13	38193150	missense	probably benign	0.09
R9143:Dsp	UTSW	13	38193361	missense	probably benign	0.05
R9450:Dsp	UTSW	13	38192403	missense	probably damaging	1.00
R9488:Dsp	UTSW	13	38193242	missense	probably benign	0.04
R9514:Dsp	UTSW	13	38187805	missense	probably benign	0.02
R9789:Dsp	UTSW	13	38183961	missense	probably benign	0.03
R9792:Dsp	UTSW	13	38195518	missense	possibly damaging	0.87
X0023:Dsp	UTSW	13	38197684	missense	probably benign	0.00
X0024:Dsp	UTSW	13	38193255	missense	probably benign	0.04
X0027:Dsp	UTSW	13	38186646	missense	possibly damaging	0.68
X0067:Dsp	UTSW	13	38182312	missense	possibly damaging	0.85
Z1176:Dsp	UTSW	13	38197190	missense	possibly damaging	0.81
Z1177:Dsp	UTSW	13	38151689	missense	probably benign	0.01
Z1177:Dsp	UTSW	13	38192854	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- GCCAACTCGGAAAATTGCAATAAG -3'
(R):5'- TCTTCCTGCAGCAGAACCC -3'

Sequencing Primer
(F):5'- GAATAAGTTCCTAGATCAGAACCTGC -3'
(R):5'- AGAACCCTCAACCTCTCTATCTCG -3'

Posted On

2015-10-21