Mutagenetix > Incidental Mutation

Incidental Mutation 'R4687:Rasa1'

353784

Institutional Source

Beutler Lab

Gene Symbol

Rasa1

Ensembl Gene

ENSMUSG00000021549

Gene Name

RAS p21 protein activator 1

Synonyms

p120-rasGAP, Gap

MMRRC Submission

041938-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4687 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

85214780-85289130 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 85226635 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 739 (D739G)

Ref Sequence

ENSEMBL: ENSMUSP00000105179 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109552]

AlphaFold

E9PYG6

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109552
AA Change: D739G

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000105179
Gene: ENSMUSG00000021549
AA Change: D739G

Domain	Start	End	E-Value	Type
low complexity region	3	32	N/A	INTRINSIC
low complexity region	37	106	N/A	INTRINSIC
low complexity region	119	142	N/A	INTRINSIC
SH2	170	253	9.44e-29	SMART
SH3	273	331	1.7e-10	SMART
SH2	340	423	7.44e-27	SMART
PH	466	570	5.11e-20	SMART
C2	586	680	6.9e-10	SMART
RasGAP	689	1035	2.77e-156	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141879

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142285

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148014

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149799

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152466

Predicted Effect

probably benign
Transcript: ENSMUST00000163713

SMART Domains

Protein: ENSMUSP00000130820
Gene: ENSMUSG00000021548

Domain	Start	End	E-Value	Type
Pfam:Cyclin_C_2	1	65	2.4e-20	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000223598
AA Change: D197G

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is located in the cytoplasm and is part of the GAP1 family of GTPase-activating proteins. The gene product stimulates the GTPase activity of normal RAS p21 but not its oncogenic counterpart. Acting as a suppressor of RAS function, the protein enhances the weak intrinsic GTPase activity of RAS proteins resulting in the inactive GDP-bound form of RAS, thereby allowing control of cellular proliferation and differentiation. Mutations leading to changes in the binding sites of either protein are associated with basal cell carcinomas. Mutations also have been associated with hereditary capillary malformations (CM) with or without arteriovenous malformations (AVM) and Parkes Weber syndrome. Alternative splicing results in two isoforms where the shorter isoform, lacking the N-terminal hydrophobic region but retaining the same activity, appears to be abundantly expressed in placental but not adult tissues. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced embryonic growth associated with defects of both yolk sac and embryonic vascular systems resulting in lethality by embryonic day 10.5. Mice homozygous for a knock-in allele exhibit increased sensitivity to induced cell death and colitis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700010I14Rik	T	A	17: 8,992,153	Y45N	probably damaging	Het
Agbl3	T	C	6: 34,798,326	V189A	probably damaging	Het
Akip1	C	A	7: 109,704,986	S90*	probably null	Het
Amn	A	T	12: 111,276,068	D439V	probably benign	Het
Arhgap17	T	A	7: 123,321,603	D149V	probably damaging	Het
Atp6v0a4	A	T	6: 38,092,465	I76N	possibly damaging	Het
Atp6v1h	A	T	1: 5,133,085	N291I	probably damaging	Het
Baiap2l2	G	T	15: 79,259,253	P462T	probably damaging	Het
Bves	C	T	10: 45,354,840		probably null	Het
Cabp7	T	A	11: 4,739,265	K127*	probably null	Het
Cacna1h	A	G	17: 25,393,910	V313A	possibly damaging	Het
Camkk2	T	C	5: 122,753,724	H245R	probably damaging	Het
Celsr1	T	A	15: 85,932,460	S1761C	possibly damaging	Het
Cfap46	T	C	7: 139,627,456	E1849G	possibly damaging	Het
Ciz1	T	C	2: 32,367,465	L174P	probably damaging	Het
Crim1	G	T	17: 78,303,025	C303F	probably damaging	Het
Cyp26c1	A	G	19: 37,692,937	Q396R	probably damaging	Het
Dnajc7	G	A	11: 100,599,300	P43L	probably damaging	Het
Dpf2	T	C	19: 5,907,012	H16R	probably damaging	Het
Dsp	A	G	13: 38,191,619	T1127A	probably damaging	Het
Dst	T	C	1: 34,201,123	L1525P	probably damaging	Het
Ehf	T	A	2: 103,267,126	D192V	probably damaging	Het
Frem1	G	T	4: 83,020,631	N71K	probably damaging	Het
Furin	T	A	7: 80,393,447	T339S	probably benign	Het
Gad1	T	A	2: 70,600,720	I569N	possibly damaging	Het
Gfi1	T	C	5: 107,723,810	K10R	probably damaging	Het
Gm20775	T	A	Y: 10,641,258		noncoding transcript	Homo
Gpn3	A	C	5: 122,378,575	D89A	possibly damaging	Het
Gpr18	T	A	14: 121,911,678	R312*	probably null	Het
Gsap	T	C	5: 21,246,971		probably benign	Het
H2-Ab1	C	A	17: 34,264,809	T48K	probably damaging	Het
Hmcn2	A	T	2: 31,438,285	N4326I	probably benign	Het
Igkv4-51	A	C	6: 69,681,730		probably benign	Het
Insr	T	C	8: 3,161,709	H1104R	probably benign	Het
Ipo13	A	T	4: 117,901,576	N697K	probably benign	Het
Iqcm	T	G	8: 75,762,989	F362V	probably damaging	Het
Irak4	T	C	15: 94,566,823	S425P	probably damaging	Het
Jakmip2	T	C	18: 43,577,412	E242G	possibly damaging	Het
Kdm4a	T	C	4: 118,144,083	K829R	probably damaging	Het
Kdr	T	C	5: 75,968,792	N145S	possibly damaging	Het
Klra9	A	T	6: 130,185,517	D185E	probably benign	Het
Lcn12	T	C	2: 25,493,321	N15S	probably benign	Het
Mei4	T	A	9: 81,927,317	M151K	probably damaging	Het
Mmp3	T	A	9: 7,451,223	S320T	probably benign	Het
Mrps5	C	G	2: 127,590,770	A37G	probably benign	Het
Mttp	A	G	3: 138,092,735	I800T	possibly damaging	Het
Nags	A	T	11: 102,148,196	Q451L	probably damaging	Het
Nbea	T	C	3: 56,058,065	T476A	probably damaging	Het
Ndufb10	T	C	17: 24,722,419	E145G	possibly damaging	Het
Neb	T	G	2: 52,304,035	S660R	possibly damaging	Het
Nppb	A	G	4: 147,986,296	K43E	probably benign	Het
Nup188	A	T	2: 30,330,633	Q906L	probably benign	Het
Olfr1259	T	C	2: 89,943,869	D82G	probably damaging	Het
Olfr1413	T	C	1: 92,573,330	I53T	possibly damaging	Het
Olfr370	T	A	8: 83,541,860	S239T	probably damaging	Het
Olfr895	C	A	9: 38,269,414	N292K	probably damaging	Het
Ovch2	T	A	7: 107,796,548	I88F	possibly damaging	Het
Palm3	A	G	8: 84,029,935	E692G	probably benign	Het
Pcsk6	T	C	7: 65,983,753	F578L	probably damaging	Het
Piezo2	A	C	18: 63,069,963	D1535E	probably damaging	Het
Ppp1r15b	T	C	1: 133,132,135	V130A	probably benign	Het
Proca1	T	C	11: 78,204,898	Y32H	probably damaging	Het
Prtg	T	A	9: 72,890,798	V682E	probably damaging	Het
Pyroxd1	A	T	6: 142,361,868	M455L	probably benign	Het
Scn3a	T	C	2: 65,464,730	I1550V	possibly damaging	Het
Sepsecs	T	C	5: 52,643,871	D483G	probably benign	Het
Setd7	T	C	3: 51,550,355	D17G	probably damaging	Het
Sipa1l2	C	T	8: 125,491,245	C451Y	probably damaging	Het
Slc31a1	A	G	4: 62,388,702	Y165C	probably damaging	Het
Smg5	T	C	3: 88,342,469	F68L	possibly damaging	Het
Sptbn5	A	G	2: 120,077,208		probably benign	Het
Stk3	A	G	15: 35,114,565	I65T	probably damaging	Het
Tas2r115	C	T	6: 132,737,284	A235T	possibly damaging	Het
Tenm2	C	T	11: 36,049,097	A1400T	probably benign	Het
Tet1	T	A	10: 62,838,791	N1169Y	probably benign	Het
Treml2	T	A	17: 48,309,397		probably null	Het
Tspan11	A	G	6: 127,938,235	E104G	probably damaging	Het
Wdtc1	G	A	4: 133,296,431	A543V	probably damaging	Het
Zfp148	T	A	16: 33,496,819	D578E	probably damaging	Het
Zfp735	A	T	11: 73,711,855	N542Y	probably damaging	Het
Zfp735	A	T	11: 73,711,856	N542I	probably damaging	Het
Zfp869	T	A	8: 69,708,143	E65D	probably benign	Het

Other mutations in Rasa1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00863:Rasa1	APN	13	85288429	missense	probably benign	0.02
IGL01396:Rasa1	APN	13	85258442	missense	probably benign	0.10
IGL01670:Rasa1	APN	13	85225490	missense	probably damaging	0.97
IGL02095:Rasa1	APN	13	85216155	missense	probably benign	0.10
IGL02822:Rasa1	APN	13	85252514	missense	probably damaging	0.97
IGL03126:Rasa1	APN	13	85256396	missense	possibly damaging	0.94
F5770:Rasa1	UTSW	13	85226945	splice site	probably null
PIT4458001:Rasa1	UTSW	13	85227118	missense	possibly damaging	0.91
R1393:Rasa1	UTSW	13	85223522	missense	probably damaging	1.00
R1441:Rasa1	UTSW	13	85252421	splice site	probably null
R1907:Rasa1	UTSW	13	85226572	nonsense	probably null
R4243:Rasa1	UTSW	13	85244195	missense	probably damaging	1.00
R4593:Rasa1	UTSW	13	85238221	splice site	probably null
R4689:Rasa1	UTSW	13	85238163	nonsense	probably null
R4753:Rasa1	UTSW	13	85288390	splice site	probably null
R4758:Rasa1	UTSW	13	85234448	missense	probably benign
R4774:Rasa1	UTSW	13	85250502	intron	probably benign
R5363:Rasa1	UTSW	13	85288555	missense	possibly damaging	0.86
R5375:Rasa1	UTSW	13	85288903	intron	probably benign
R6134:Rasa1	UTSW	13	85226626	missense	probably benign	0.01
R6190:Rasa1	UTSW	13	85233695	missense	probably benign	0.02
R6755:Rasa1	UTSW	13	85226598	missense	possibly damaging	0.49
R7564:Rasa1	UTSW	13	85228708	missense	probably benign	0.09
R7862:Rasa1	UTSW	13	85255411	missense	probably damaging	0.99
R9138:Rasa1	UTSW	13	85221516	missense	possibly damaging	0.93
R9280:Rasa1	UTSW	13	85288613	missense	unknown
R9328:Rasa1	UTSW	13	85255456	critical splice acceptor site	probably null
R9340:Rasa1	UTSW	13	85221530	missense	probably damaging	0.98
RF016:Rasa1	UTSW	13	85223488	missense	possibly damaging	0.65
X0023:Rasa1	UTSW	13	85233734	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACAGTGGCCTTGGAACTGATATAG -3'
(R):5'- CCTATATTAATGGCAGAGAAGAAGC -3'

Sequencing Primer
(F):5'- GCCTTGGAACTGATATAGAATGTAG -3'
(R):5'- CTTGTTGTGTACTTTCAGCA -3'

Posted On

2015-10-21