Incidental Mutation 'R4687:H2-Ab1'
ID353796
Institutional Source Beutler Lab
Gene Symbol H2-Ab1
Ensembl Gene ENSMUSG00000073421
Gene Namehistocompatibility 2, class II antigen A, beta 1
SynonymsA beta, Abeta, Ia-2, IAb, Rmcs1, I-A, H-2Ab, I-Abeta, Ia2, H2-Ab
MMRRC Submission 041938-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R4687 (G1)
Quality Score146
Status Not validated
Chromosome17
Chromosomal Location34263209-34269418 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 34264809 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 48 (T48K)
Ref Sequence ENSEMBL: ENSMUSP00000041008 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040828]
PDB Structure CRYSTAL STRUCTURE OF CLASS II MHC MOLECULE IAb BOUND TO EALPHA3K PEPTIDE [X-RAY DIFFRACTION]
Crystal structure of murine class II MHC I-Ab in complex with a human CLIP peptide [X-RAY DIFFRACTION]
Crystal structure of mouse MHC class II I-Ab/3K peptide complexed with mouse TCR B3K506 [X-RAY DIFFRACTION]
Crystal structure of mouse MHC class II I-Ab/3K peptide complexed with mouse TCR YAe62 [X-RAY DIFFRACTION]
Crystal structure of mouse MHC class II I-Ab/3K peptide complexed with mouse TCR 2W20 [X-RAY DIFFRACTION]
Crystal Structure of 809.B5 TCR complexed with MHC Class II I-Ab/3k peptide [X-RAY DIFFRACTION]
J809.B5 TCR bound to IAb/3K [X-RAY DIFFRACTION]
J809.B5 Y31A TCR bound to IAb3K [X-RAY DIFFRACTION]
14.C6 TCR complexed with MHC class II I-Ab/3K peptide [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000040828
AA Change: T48K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000041008
Gene: ENSMUSG00000073421
AA Change: T48K

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
MHC_II_beta 40 114 1.53e-47 SMART
IGc1 140 211 8.47e-34 SMART
transmembrane domain 228 247 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173103
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174875
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HLA-DQB1 belongs to the HLA class II beta chain paralogs. This class II molecule is a heterodimer consisting of an alpha (DQA) and a beta chain (DQB), both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The beta chain is approximately 26-28 kDa and it contains six exons. Exon 1 encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and exon 5 encodes the cytoplasmic tail. Within the DQ molecule both the alpha chain and the beta chain contain the polymorphisms specifying the peptide binding specificities, resulting in up to four different molecules. Typing for these polymorphisms is routinely done for bone marrow transplantation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit depletion of mature CD4+ T cells, deficiency in cell-mediated immune responses, and increased susceptibility to viral infections. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T A 17: 8,992,153 Y45N probably damaging Het
Agbl3 T C 6: 34,798,326 V189A probably damaging Het
Akip1 C A 7: 109,704,986 S90* probably null Het
Amn A T 12: 111,276,068 D439V probably benign Het
Arhgap17 T A 7: 123,321,603 D149V probably damaging Het
Atp6v0a4 A T 6: 38,092,465 I76N possibly damaging Het
Atp6v1h A T 1: 5,133,085 N291I probably damaging Het
Baiap2l2 G T 15: 79,259,253 P462T probably damaging Het
Bves C T 10: 45,354,840 probably null Het
Cabp7 T A 11: 4,739,265 K127* probably null Het
Cacna1h A G 17: 25,393,910 V313A possibly damaging Het
Camkk2 T C 5: 122,753,724 H245R probably damaging Het
Celsr1 T A 15: 85,932,460 S1761C possibly damaging Het
Cfap46 T C 7: 139,627,456 E1849G possibly damaging Het
Ciz1 T C 2: 32,367,465 L174P probably damaging Het
Crim1 G T 17: 78,303,025 C303F probably damaging Het
Cyp26c1 A G 19: 37,692,937 Q396R probably damaging Het
Dnajc7 G A 11: 100,599,300 P43L probably damaging Het
Dpf2 T C 19: 5,907,012 H16R probably damaging Het
Dsp A G 13: 38,191,619 T1127A probably damaging Het
Dst T C 1: 34,201,123 L1525P probably damaging Het
Ehf T A 2: 103,267,126 D192V probably damaging Het
Frem1 G T 4: 83,020,631 N71K probably damaging Het
Furin T A 7: 80,393,447 T339S probably benign Het
Gad1 T A 2: 70,600,720 I569N possibly damaging Het
Gfi1 T C 5: 107,723,810 K10R probably damaging Het
Gm20775 T A Y: 10,641,258 noncoding transcript Homo
Gpn3 A C 5: 122,378,575 D89A possibly damaging Het
Gpr18 T A 14: 121,911,678 R312* probably null Het
Gsap T C 5: 21,246,971 probably benign Het
Hmcn2 A T 2: 31,438,285 N4326I probably benign Het
Igkv4-51 A C 6: 69,681,730 probably benign Het
Insr T C 8: 3,161,709 H1104R probably benign Het
Ipo13 A T 4: 117,901,576 N697K probably benign Het
Iqcm T G 8: 75,762,989 F362V probably damaging Het
Irak4 T C 15: 94,566,823 S425P probably damaging Het
Jakmip2 T C 18: 43,577,412 E242G possibly damaging Het
Kdm4a T C 4: 118,144,083 K829R probably damaging Het
Kdr T C 5: 75,968,792 N145S possibly damaging Het
Klra9 A T 6: 130,185,517 D185E probably benign Het
Lcn12 T C 2: 25,493,321 N15S probably benign Het
Mei4 T A 9: 81,927,317 M151K probably damaging Het
Mmp3 T A 9: 7,451,223 S320T probably benign Het
Mrps5 C G 2: 127,590,770 A37G probably benign Het
Mttp A G 3: 138,092,735 I800T possibly damaging Het
Nags A T 11: 102,148,196 Q451L probably damaging Het
Nbea T C 3: 56,058,065 T476A probably damaging Het
Ndufb10 T C 17: 24,722,419 E145G possibly damaging Het
Neb T G 2: 52,304,035 S660R possibly damaging Het
Nppb A G 4: 147,986,296 K43E probably benign Het
Nup188 A T 2: 30,330,633 Q906L probably benign Het
Olfr1259 T C 2: 89,943,869 D82G probably damaging Het
Olfr1413 T C 1: 92,573,330 I53T possibly damaging Het
Olfr370 T A 8: 83,541,860 S239T probably damaging Het
Olfr895 C A 9: 38,269,414 N292K probably damaging Het
Ovch2 T A 7: 107,796,548 I88F possibly damaging Het
Palm3 A G 8: 84,029,935 E692G probably benign Het
Pcsk6 T C 7: 65,983,753 F578L probably damaging Het
Piezo2 A C 18: 63,069,963 D1535E probably damaging Het
Ppp1r15b T C 1: 133,132,135 V130A probably benign Het
Proca1 T C 11: 78,204,898 Y32H probably damaging Het
Prtg T A 9: 72,890,798 V682E probably damaging Het
Pyroxd1 A T 6: 142,361,868 M455L probably benign Het
Rasa1 T C 13: 85,226,635 D739G possibly damaging Het
Scn3a T C 2: 65,464,730 I1550V possibly damaging Het
Sepsecs T C 5: 52,643,871 D483G probably benign Het
Setd7 T C 3: 51,550,355 D17G probably damaging Het
Sipa1l2 C T 8: 125,491,245 C451Y probably damaging Het
Slc31a1 A G 4: 62,388,702 Y165C probably damaging Het
Smg5 T C 3: 88,342,469 F68L possibly damaging Het
Sptbn5 A G 2: 120,077,208 probably benign Het
Stk3 A G 15: 35,114,565 I65T probably damaging Het
Tas2r115 C T 6: 132,737,284 A235T possibly damaging Het
Tenm2 C T 11: 36,049,097 A1400T probably benign Het
Tet1 T A 10: 62,838,791 N1169Y probably benign Het
Treml2 T A 17: 48,309,397 probably null Het
Tspan11 A G 6: 127,938,235 E104G probably damaging Het
Wdtc1 G A 4: 133,296,431 A543V probably damaging Het
Zfp148 T A 16: 33,496,819 D578E probably damaging Het
Zfp735 A T 11: 73,711,855 N542Y probably damaging Het
Zfp735 A T 11: 73,711,856 N542I probably damaging Het
Zfp869 T A 8: 69,708,143 E65D probably benign Het
Other mutations in H2-Ab1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:H2-Ab1 APN 17 34267575 missense probably damaging 1.00
IGL01941:H2-Ab1 APN 17 34267434 nonsense probably null
IGL02826:H2-Ab1 APN 17 34264911 missense probably damaging 0.98
R0479:H2-Ab1 UTSW 17 34264968 missense possibly damaging 0.68
R0815:H2-Ab1 UTSW 17 34267354 missense probably damaging 0.99
R0863:H2-Ab1 UTSW 17 34267354 missense probably damaging 0.99
R1796:H2-Ab1 UTSW 17 34267372 missense probably damaging 0.99
R2875:H2-Ab1 UTSW 17 34263312 start codon destroyed probably benign 0.21
R4042:H2-Ab1 UTSW 17 34264860 missense probably benign
R4761:H2-Ab1 UTSW 17 34267500 missense probably damaging 0.98
R4787:H2-Ab1 UTSW 17 34267467 missense possibly damaging 0.92
R5111:H2-Ab1 UTSW 17 34267482 missense probably damaging 0.96
R5155:H2-Ab1 UTSW 17 34267384 missense possibly damaging 0.89
R5194:H2-Ab1 UTSW 17 34269378 utr 3 prime probably benign
R6869:H2-Ab1 UTSW 17 34267563 missense probably damaging 1.00
R7037:H2-Ab1 UTSW 17 34267989 missense probably damaging 0.99
R7054:H2-Ab1 UTSW 17 34263342 missense probably benign 0.41
R7250:H2-Ab1 UTSW 17 34267507 missense probably damaging 1.00
R8295:H2-Ab1 UTSW 17 34264842 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTTGCACACAGGAGAGAGTC -3'
(R):5'- CCTCGTAGTTGTGTCTGCAC -3'

Sequencing Primer
(F):5'- ATGTACCAAGTACCGTTTGCG -3'
(R):5'- TGTCTGCACACCGTGTCCAG -3'
Posted On2015-10-21