Mutagenetix > Incidental Mutation

Incidental Mutation 'R4688:Plxna2'

353812

Institutional Source

Beutler Lab

Gene Symbol

Plxna2

Ensembl Gene

ENSMUSG00000026640

Gene Name

plexin A2

Synonyms

2810428A13Rik, OCT, PlexA2, Plxn2

MMRRC Submission

041939-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4688 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

194618218-194816869 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 194644445 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 229 (P229L)

Ref Sequence

ENSEMBL: ENSMUSP00000027952 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027952]

AlphaFold

P70207

PDB Structure

Plexin A2 / Semaphorin 6A complex [X-RAY DIFFRACTION]
Mouse Plexin A2 extracellular domain [X-RAY DIFFRACTION]
Mouse Plexin A2, extracellular domains 1-4 [X-RAY DIFFRACTION]
Plexin A2 in complex with Semaphorin 6A [X-RAY DIFFRACTION]
Complex of mouse Plexin A2 - Semaphorin 3A - Neuropilin-1 [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000027952
AA Change: P229L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000027952
Gene: ENSMUSG00000026640
AA Change: P229L

Domain	Start	End	E-Value	Type
low complexity region	16	29	N/A	INTRINSIC
Sema	50	492	1.65e-132	SMART
PSI	510	560	8e-12	SMART
PSI	655	702	6.35e-6	SMART
PSI	803	856	1.24e-8	SMART
IPT	857	952	6.36e-21	SMART
IPT	953	1038	1.02e-24	SMART
IPT	1040	1140	1.48e-21	SMART
IPT	1142	1237	8.81e-6	SMART
transmembrane domain	1238	1260	N/A	INTRINSIC
Pfam:Plexin_cytopl	1311	1864	1.9e-261	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125381

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 94.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the plexin-A family of semaphorin co-receptors. Semaphorins are a large family of secreted or membrane-bound proteins that mediate repulsive effects on axon pathfinding during nervous system development. A subset of semaphorins are recognized by plexin-A/neuropilin transmembrane receptor complexes, triggering a cellular signal transduction cascade that leads to axon repulsion. This plexin-A family member is thought to transduce signals from semaphorin-3A and -3C. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show abnormal granule cell migration in the adult cerebellum and aberrant projection of mossy fibers in hippocampal slices. Mice homozygous for an ENU-induced allele are smaller and show granule cell migration defects and mild ataxia with incomplete penetrance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 96 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	G	11: 23,593,449	S530P	probably benign	Het
1700003E16Rik	A	G	6: 83,162,698	N535S	probably damaging	Het
2810403A07Rik	T	A	3: 88,686,517	M71K	probably damaging	Het
9930021J03Rik	A	G	19: 29,717,101	I1664T	probably benign	Het
Abcc12	T	C	8: 86,548,694	S452G	possibly damaging	Het
Acacb	C	A	5: 114,204,763	Q897K	probably benign	Het
Acot3	C	A	12: 84,053,917	R145S	probably damaging	Het
AI314180	A	G	4: 58,840,757	V667A	probably damaging	Het
Ankrd54	A	T	15: 79,054,582	Y247N	probably damaging	Het
Arl11	G	A	14: 61,311,097	V119I	probably benign	Het
Atxn7	T	A	14: 14,089,288	M268K	probably benign	Het
Bms1	G	A	6: 118,392,706	R934C	probably damaging	Het
Ccdc129	G	A	6: 55,967,147		probably null	Het
Chrnb3	T	C	8: 27,394,119	S295P	probably damaging	Het
Cic	TCCCCC	TCCCCCCC	7: 25,291,670		probably null	Het
Cnr1	A	T	4: 33,944,571	I320F	probably benign	Het
Cntn4	C	T	6: 106,437,949	P147L	probably damaging	Het
Col24a1	G	A	3: 145,314,383	V172I	probably benign	Het
Col9a3	A	G	2: 180,607,631	D262G	probably damaging	Het
Csrnp2	A	G	15: 100,482,360	V350A	probably damaging	Het
D630045J12Rik	A	G	6: 38,196,657	V192A	possibly damaging	Het
Deptor	A	G	15: 55,208,781	M219V	probably benign	Het
Dmrtb1	A	T	4: 107,684,050	L38Q	probably damaging	Het
Dvl2	G	A	11: 70,007,518	R367Q	possibly damaging	Het
Dync1h1	T	G	12: 110,655,528	I3435S	probably damaging	Het
Eif2b3	A	G	4: 117,058,849	N218D	probably benign	Het
Epha2	A	G	4: 141,318,981	D497G	probably benign	Het
Epha7	G	T	4: 28,821,367	L177F	probably damaging	Het
Fam214b	A	G	4: 43,034,663	F352S	probably damaging	Het
Fam98c	C	T	7: 29,155,241	E147K	probably damaging	Het
Fbxo17	A	G	7: 28,732,554	T19A	probably benign	Het
Fbxo47	A	G	11: 97,856,223	F339S	probably damaging	Het
Frmd4a	G	T	2: 4,537,311	V234L	possibly damaging	Het
Gal3st2	A	G	1: 93,872,523	D32G	probably damaging	Het
Gpr135	T	C	12: 72,070,946	T16A	probably benign	Het
Gpr160	A	T	3: 30,896,686	R302S	probably benign	Het
Hrh2	C	A	13: 54,214,801	N265K	probably benign	Het
Htatip2	C	A	7: 49,773,423	A242E	probably damaging	Het
Igfbp7	T	C	5: 77,407,635	Y127C	probably damaging	Het
Igkv16-104	A	G	6: 68,425,894	Q57R	possibly damaging	Het
Ino80c	A	G	18: 24,108,846	S161P	probably damaging	Het
Kcnc1	A	G	7: 46,397,835	D53G	probably benign	Het
Lce1h	G	T	3: 92,763,567	R93S	unknown	Het
Lce1k	T	C	3: 92,806,644	S78G	unknown	Het
Lhcgr	T	A	17: 88,765,152	I156F	probably damaging	Het
Lpl	T	C	8: 68,899,425	Y343H	probably damaging	Het
Lrp6	G	T	6: 134,479,743	R853S	probably damaging	Het
Lrrc7	A	G	3: 158,148,605	V1322A	probably damaging	Het
Lrrc74a	C	T	12: 86,737,698	Q67*	probably null	Het
Megf6	A	T	4: 154,253,814	D447V	probably damaging	Het
Mep1a	T	C	17: 43,482,248	D355G	possibly damaging	Het
Ncoa1	T	C	12: 4,315,781	D95G	probably benign	Het
Npepl1	A	T	2: 174,114,442	I139F	possibly damaging	Het
Nrcam	T	C	12: 44,547,237	S262P	probably benign	Het
Nrp1	A	G	8: 128,502,566	N842D	probably benign	Het
Olfml3	A	G	3: 103,732,181		probably benign	Het
Olfr1375	A	G	11: 51,048,988	R294G	probably damaging	Het
Olfr1505	A	T	19: 13,919,241	T74S	probably benign	Het
Olfr32	T	A	2: 90,138,999	N47Y	possibly damaging	Het
Olfr421-ps1	T	C	1: 174,151,596	Y27H	possibly damaging	Het
Olfr711	T	A	7: 106,971,861	Y161F	probably benign	Het
Olfr773	G	A	10: 129,186,645	P259S	probably damaging	Het
Olfr918	A	G	9: 38,673,363	L27P	probably damaging	Het
Pde2a	A	G	7: 101,502,834	N316S	probably benign	Het
Pde4dip	T	A	3: 97,843,677	R74*	probably null	Het
Pex13	A	T	11: 23,655,472	W253R	possibly damaging	Het
Piezo1	A	T	8: 122,488,539	W1444R	probably damaging	Het
Pla2g4e	T	C	2: 120,167,933	K843R	possibly damaging	Het
Prelid3b	G	T	2: 174,466,799	T131K	probably benign	Het
Pros1	T	C	16: 62,889,007		probably null	Het
Prrc2c	G	T	1: 162,697,687	P450Q	unknown	Het
Ptbp1	G	T	10: 79,856,508	V5F	possibly damaging	Het
Ptk2	T	A	15: 73,206,225	L997F	probably damaging	Het
Rims1	G	T	1: 22,479,447	S525*	probably null	Het
Sh2b3	T	A	5: 121,818,634	D318V	probably benign	Het
Slc16a13	A	T	11: 70,220,275	I88N	probably damaging	Het
Slit2	T	A	5: 48,257,003		probably null	Het
Snx10	A	G	6: 51,579,938	N67S	probably damaging	Het
Stil	A	G	4: 115,041,308	Y1045C	probably damaging	Het
Stra6	A	G	9: 58,135,076		probably null	Het
Sympk	A	G	7: 19,054,410	S1254G	probably benign	Het
Syt15	G	T	14: 34,228,054	G377V	probably damaging	Het
Taar4	A	T	10: 23,960,833	I114F	probably damaging	Het
Tcaf3	G	A	6: 42,593,366		probably null	Het
Tgm7	A	T	2: 121,094,021	N558K	probably benign	Het
Tln2	T	G	9: 67,397,653	M1L	probably benign	Het
Trim50	C	T	5: 135,367,140	T314I	probably damaging	Het
Trp53rka	A	T	2: 165,491,392	Y192*	probably null	Het
Ube3b	T	C	5: 114,393,078	V211A	probably benign	Het
Ush2a	A	G	1: 188,399,941	S787G	probably benign	Het
Vmn1r189	T	C	13: 22,102,119	M183V	probably damaging	Het
Vps13d	G	T	4: 145,178,212	Q115K	probably benign	Het
Zfp358	A	G	8: 3,495,493	D25G	probably damaging	Het
Zfp521	T	G	18: 13,844,590	K922T	probably damaging	Het
Zfp521	T	A	18: 13,844,591	K922*	probably null	Het
Zfp68	T	A	5: 138,616,481	K4*	probably null	Het

Other mutations in Plxna2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00227:Plxna2	APN	1	194644657	missense	probably damaging	1.00
IGL00332:Plxna2	APN	1	194789830	missense	probably damaging	0.98
IGL00392:Plxna2	APN	1	194800568	missense	probably damaging	1.00
IGL00432:Plxna2	APN	1	194644096	missense	probably benign	0.03
IGL00704:Plxna2	APN	1	194751461	missense	probably damaging	0.99
IGL00737:Plxna2	APN	1	194746239	splice site	probably benign
IGL01078:Plxna2	APN	1	194786693	unclassified	probably benign
IGL01354:Plxna2	APN	1	194762435	missense	probably benign	0.02
IGL01432:Plxna2	APN	1	194644318	missense	possibly damaging	0.58
IGL01459:Plxna2	APN	1	194764570	missense	probably benign	0.00
IGL01525:Plxna2	APN	1	194712311	missense	probably benign	0.00
IGL01656:Plxna2	APN	1	194790161	missense	possibly damaging	0.52
IGL01825:Plxna2	APN	1	194788902	missense	probably damaging	0.98
IGL01862:Plxna2	APN	1	194643950	missense	possibly damaging	0.87
IGL01899:Plxna2	APN	1	194751488	missense	probably damaging	1.00
IGL01996:Plxna2	APN	1	194799776	missense	probably damaging	0.99
IGL02123:Plxna2	APN	1	194794383	missense	probably damaging	1.00
IGL02226:Plxna2	APN	1	194644424	missense	probably damaging	1.00
IGL02227:Plxna2	APN	1	194752089	missense	probably damaging	1.00
IGL02415:Plxna2	APN	1	194643964	missense	probably damaging	1.00
IGL02440:Plxna2	APN	1	194746150	missense	probably benign	0.10
IGL02545:Plxna2	APN	1	194786690	unclassified	probably benign
IGL02553:Plxna2	APN	1	194751438	missense	probably benign	0.08
IGL02882:Plxna2	APN	1	194762570	missense	probably damaging	1.00
IGL02946:Plxna2	APN	1	194749309	splice site	probably benign
IGL03062:Plxna2	APN	1	194762550	missense	possibly damaging	0.72
IGL03095:Plxna2	APN	1	194801127	missense	probably damaging	1.00
IGL03293:Plxna2	APN	1	194804945	missense	probably damaging	0.99
G1Funyon:Plxna2	UTSW	1	194790175	missense	probably benign	0.01
PIT4514001:Plxna2	UTSW	1	194794937	missense	probably benign	0.00
R0024:Plxna2	UTSW	1	194643995	missense	possibly damaging	0.57
R0040:Plxna2	UTSW	1	194643896	missense	probably benign	0.13
R0040:Plxna2	UTSW	1	194643896	missense	probably benign	0.13
R0063:Plxna2	UTSW	1	194644939	missense	probably benign	0.00
R0063:Plxna2	UTSW	1	194644939	missense	probably benign	0.00
R0217:Plxna2	UTSW	1	194644598	missense	probably damaging	1.00
R0316:Plxna2	UTSW	1	194644150	missense	probably damaging	1.00
R0440:Plxna2	UTSW	1	194644404	nonsense	probably null
R0505:Plxna2	UTSW	1	194644348	missense	possibly damaging	0.93
R0568:Plxna2	UTSW	1	194751386	missense	probably benign	0.00
R0669:Plxna2	UTSW	1	194788837	missense	probably damaging	0.99
R0674:Plxna2	UTSW	1	194649475	missense	probably benign	0.00
R0885:Plxna2	UTSW	1	194644556	missense	probably benign
R0898:Plxna2	UTSW	1	194797024	missense	probably damaging	1.00
R0940:Plxna2	UTSW	1	194800555	missense	probably benign	0.01
R1061:Plxna2	UTSW	1	194644093	missense	probably damaging	1.00
R1067:Plxna2	UTSW	1	194780510	splice site	probably null
R1222:Plxna2	UTSW	1	194800649	missense	probably damaging	1.00
R1345:Plxna2	UTSW	1	194644486	missense	probably damaging	1.00
R1363:Plxna2	UTSW	1	194804939	nonsense	probably null
R1432:Plxna2	UTSW	1	194767463	missense	probably benign	0.10
R1434:Plxna2	UTSW	1	194751540	splice site	probably benign
R1597:Plxna2	UTSW	1	194749306	splice site	probably benign
R1719:Plxna2	UTSW	1	194644370	missense	possibly damaging	0.93
R1778:Plxna2	UTSW	1	194810970	missense	probably benign	0.01
R1795:Plxna2	UTSW	1	194806303	missense	probably damaging	0.99
R1819:Plxna2	UTSW	1	194790186	missense	probably benign	0.03
R1926:Plxna2	UTSW	1	194762450	missense	probably benign	0.02
R1966:Plxna2	UTSW	1	194644700	missense	possibly damaging	0.91
R1987:Plxna2	UTSW	1	194643989	missense	probably damaging	1.00
R1988:Plxna2	UTSW	1	194643989	missense	probably damaging	1.00
R2034:Plxna2	UTSW	1	194780594	missense	probably benign	0.00
R2131:Plxna2	UTSW	1	194644750	missense	probably benign	0.01
R2171:Plxna2	UTSW	1	194800617	missense	probably damaging	1.00
R2217:Plxna2	UTSW	1	194797748	missense	probably damaging	1.00
R2311:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2340:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2342:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2423:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2424:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2425:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2842:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2971:Plxna2	UTSW	1	194797731	missense	probably damaging	1.00
R3236:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R3731:Plxna2	UTSW	1	194788885	missense	probably benign	0.42
R3783:Plxna2	UTSW	1	194807521	missense	probably damaging	1.00
R3784:Plxna2	UTSW	1	194644617	missense	probably benign
R3787:Plxna2	UTSW	1	194643934	missense	probably benign	0.10
R3845:Plxna2	UTSW	1	194793790	missense	probably damaging	0.96
R3927:Plxna2	UTSW	1	194746157	missense	probably benign	0.02
R3930:Plxna2	UTSW	1	194794910	missense	probably benign	0.17
R3964:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R3980:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4067:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4120:Plxna2	UTSW	1	194780627	missense	probably damaging	1.00
R4231:Plxna2	UTSW	1	194644454	missense	probably damaging	1.00
R4257:Plxna2	UTSW	1	194644775	missense	probably damaging	1.00
R4396:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4397:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4418:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4444:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4446:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4482:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4487:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4489:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4571:Plxna2	UTSW	1	194810988	missense	possibly damaging	0.91
R4622:Plxna2	UTSW	1	194812150	missense	probably benign
R4623:Plxna2	UTSW	1	194812150	missense	probably benign
R4684:Plxna2	UTSW	1	194762594	missense	probably benign	0.42
R4855:Plxna2	UTSW	1	194797732	missense	probably benign	0.39
R4876:Plxna2	UTSW	1	194643775	missense	probably benign	0.02
R5161:Plxna2	UTSW	1	194751404	missense	probably benign
R5207:Plxna2	UTSW	1	194788899	missense	probably benign	0.19
R5479:Plxna2	UTSW	1	194793873	missense	probably benign
R5931:Plxna2	UTSW	1	194810870	missense	probably damaging	1.00
R6026:Plxna2	UTSW	1	194799814	missense	probably damaging	1.00
R6029:Plxna2	UTSW	1	194794427	missense	probably benign	0.00
R6029:Plxna2	UTSW	1	194799575	missense	probably damaging	1.00
R6059:Plxna2	UTSW	1	194810971	missense	possibly damaging	0.79
R6238:Plxna2	UTSW	1	194790196	missense	probably benign	0.01
R6322:Plxna2	UTSW	1	194754367	missense	possibly damaging	0.89
R6668:Plxna2	UTSW	1	194810088	missense	possibly damaging	0.68
R6709:Plxna2	UTSW	1	194789766	missense	probably benign	0.01
R6748:Plxna2	UTSW	1	194794182	splice site	probably null
R6838:Plxna2	UTSW	1	194804914	missense	possibly damaging	0.90
R6844:Plxna2	UTSW	1	194793828	missense	probably benign	0.08
R7069:Plxna2	UTSW	1	194793904	missense	possibly damaging	0.51
R7122:Plxna2	UTSW	1	194644568	nonsense	probably null
R7145:Plxna2	UTSW	1	194649522	missense	probably benign	0.31
R7189:Plxna2	UTSW	1	194801058	missense	possibly damaging	0.58
R7207:Plxna2	UTSW	1	194644019	missense	probably damaging	1.00
R7232:Plxna2	UTSW	1	194712260	missense	probably damaging	1.00
R7234:Plxna2	UTSW	1	194806390	missense	probably damaging	0.96
R7246:Plxna2	UTSW	1	194644282	missense	possibly damaging	0.74
R7255:Plxna2	UTSW	1	194752103	missense	probably benign	0.03
R7283:Plxna2	UTSW	1	194644883	missense	probably damaging	0.99
R7288:Plxna2	UTSW	1	194796919	missense	probably damaging	1.00
R7361:Plxna2	UTSW	1	194799779	missense	probably damaging	1.00
R7424:Plxna2	UTSW	1	194806339	missense	probably damaging	0.98
R7501:Plxna2	UTSW	1	194643895	missense	possibly damaging	0.95
R7528:Plxna2	UTSW	1	194812156	missense	probably damaging	1.00
R7529:Plxna2	UTSW	1	194643871	missense	probably benign	0.25
R7532:Plxna2	UTSW	1	194644819	missense	probably benign	0.13
R7959:Plxna2	UTSW	1	194793864	frame shift	probably null
R7959:Plxna2	UTSW	1	194810962	missense	probably damaging	1.00
R7960:Plxna2	UTSW	1	194793864	frame shift	probably null
R8261:Plxna2	UTSW	1	194749416	missense	probably damaging	1.00
R8301:Plxna2	UTSW	1	194790175	missense	probably benign	0.01
R8463:Plxna2	UTSW	1	194644046	missense	probably damaging	1.00
R8519:Plxna2	UTSW	1	194793958	missense	probably damaging	1.00
R8836:Plxna2	UTSW	1	194796935	missense	possibly damaging	0.94
R9010:Plxna2	UTSW	1	194788909	missense	possibly damaging	0.95
R9034:Plxna2	UTSW	1	194793889	missense	probably damaging	1.00
R9254:Plxna2	UTSW	1	194810166	missense	probably damaging	1.00
R9274:Plxna2	UTSW	1	194788828	missense	probably damaging	1.00
R9379:Plxna2	UTSW	1	194810166	missense	probably damaging	1.00
R9385:Plxna2	UTSW	1	194749416	missense	possibly damaging	0.95
R9422:Plxna2	UTSW	1	194644422	missense	probably damaging	1.00
R9451:Plxna2	UTSW	1	194644384	missense	probably benign	0.05
R9484:Plxna2	UTSW	1	194644894	missense	probably damaging	1.00
X0027:Plxna2	UTSW	1	194644433	missense	probably damaging	1.00
Z1088:Plxna2	UTSW	1	194644441	missense	possibly damaging	0.56
Z1088:Plxna2	UTSW	1	194764539	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- AAGGAACACTACTTGTCCAGTG -3'
(R):5'- ACTTGGGGTCATCCTTGCAG -3'

Sequencing Primer
(F):5'- TCAATAAGACAGGCACCATGTATG -3'
(R):5'- CTTGCAGAGACGCACAATTCTTGAG -3'

Posted On

2015-10-21