Incidental Mutation 'R4688:Epha7'
ID353831
Institutional Source Beutler Lab
Gene Symbol Epha7
Ensembl Gene ENSMUSG00000028289
Gene NameEph receptor A7
SynonymsEhk3, Hek11, Cek11, MDK1, Ebk, Mdk1
MMRRC Submission 041939-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.546) question?
Stock #R4688 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location28813131-28967499 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 28821367 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 177 (L177F)
Ref Sequence ENSEMBL: ENSMUSP00000103829 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029964] [ENSMUST00000080934] [ENSMUST00000108191] [ENSMUST00000108194]
Predicted Effect probably damaging
Transcript: ENSMUST00000029964
AA Change: L177F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029964
Gene: ENSMUSG00000028289
AA Change: L177F

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EPH_lbd 32 205 3.24e-126 SMART
FN3 332 422 2.39e-8 SMART
FN3 443 524 3.12e-12 SMART
Pfam:EphA2_TM 557 630 4.4e-25 PFAM
TyrKc 633 890 8.84e-139 SMART
SAM 920 987 1.26e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000080934
AA Change: L177F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079735
Gene: ENSMUSG00000028289
AA Change: L177F

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EPH_lbd 32 205 3.24e-126 SMART
FN3 332 422 2.39e-8 SMART
FN3 443 524 3.12e-12 SMART
transmembrane domain 556 578 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108191
AA Change: L177F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103826
Gene: ENSMUSG00000028289
AA Change: L177F

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EPH_lbd 32 205 3.24e-126 SMART
FN3 332 422 2.39e-8 SMART
FN3 443 524 3.12e-12 SMART
Pfam:EphA2_TM 556 626 2.9e-23 PFAM
TyrKc 629 886 8.84e-139 SMART
SAM 916 983 1.26e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108194
AA Change: L177F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103829
Gene: ENSMUSG00000028289
AA Change: L177F

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EPH_lbd 32 205 3.24e-126 SMART
FN3 332 422 2.39e-8 SMART
FN3 443 524 3.12e-12 SMART
transmembrane domain 556 578 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136827
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149030
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Increased expression of this gene is associated with multiple forms of carcinoma. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Some homozygous mutants display anencephaly. Mutants also exhibit increased proliferation of neural progenitor cells in the lateral ventricle wall of the adult brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,593,449 S530P probably benign Het
1700003E16Rik A G 6: 83,162,698 N535S probably damaging Het
2810403A07Rik T A 3: 88,686,517 M71K probably damaging Het
9930021J03Rik A G 19: 29,717,101 I1664T probably benign Het
Abcc12 T C 8: 86,548,694 S452G possibly damaging Het
Acacb C A 5: 114,204,763 Q897K probably benign Het
Acot3 C A 12: 84,053,917 R145S probably damaging Het
AI314180 A G 4: 58,840,757 V667A probably damaging Het
Ankrd54 A T 15: 79,054,582 Y247N probably damaging Het
Arl11 G A 14: 61,311,097 V119I probably benign Het
Atxn7 T A 14: 14,089,288 M268K probably benign Het
Bms1 G A 6: 118,392,706 R934C probably damaging Het
Ccdc129 G A 6: 55,967,147 probably null Het
Chrnb3 T C 8: 27,394,119 S295P probably damaging Het
Cic TCCCCC TCCCCCCC 7: 25,291,670 probably null Het
Cnr1 A T 4: 33,944,571 I320F probably benign Het
Cntn4 C T 6: 106,437,949 P147L probably damaging Het
Col24a1 G A 3: 145,314,383 V172I probably benign Het
Col9a3 A G 2: 180,607,631 D262G probably damaging Het
Csrnp2 A G 15: 100,482,360 V350A probably damaging Het
D630045J12Rik A G 6: 38,196,657 V192A possibly damaging Het
Deptor A G 15: 55,208,781 M219V probably benign Het
Dmrtb1 A T 4: 107,684,050 L38Q probably damaging Het
Dvl2 G A 11: 70,007,518 R367Q possibly damaging Het
Dync1h1 T G 12: 110,655,528 I3435S probably damaging Het
Eif2b3 A G 4: 117,058,849 N218D probably benign Het
Epha2 A G 4: 141,318,981 D497G probably benign Het
Fam214b A G 4: 43,034,663 F352S probably damaging Het
Fam98c C T 7: 29,155,241 E147K probably damaging Het
Fbxo17 A G 7: 28,732,554 T19A probably benign Het
Fbxo47 A G 11: 97,856,223 F339S probably damaging Het
Frmd4a G T 2: 4,537,311 V234L possibly damaging Het
Gal3st2 A G 1: 93,872,523 D32G probably damaging Het
Gpr135 T C 12: 72,070,946 T16A probably benign Het
Gpr160 A T 3: 30,896,686 R302S probably benign Het
Hrh2 C A 13: 54,214,801 N265K probably benign Het
Htatip2 C A 7: 49,773,423 A242E probably damaging Het
Igfbp7 T C 5: 77,407,635 Y127C probably damaging Het
Igkv16-104 A G 6: 68,425,894 Q57R possibly damaging Het
Ino80c A G 18: 24,108,846 S161P probably damaging Het
Kcnc1 A G 7: 46,397,835 D53G probably benign Het
Lce1h G T 3: 92,763,567 R93S unknown Het
Lce1k T C 3: 92,806,644 S78G unknown Het
Lhcgr T A 17: 88,765,152 I156F probably damaging Het
Lpl T C 8: 68,899,425 Y343H probably damaging Het
Lrp6 G T 6: 134,479,743 R853S probably damaging Het
Lrrc7 A G 3: 158,148,605 V1322A probably damaging Het
Lrrc74a C T 12: 86,737,698 Q67* probably null Het
Megf6 A T 4: 154,253,814 D447V probably damaging Het
Mep1a T C 17: 43,482,248 D355G possibly damaging Het
Ncoa1 T C 12: 4,315,781 D95G probably benign Het
Npepl1 A T 2: 174,114,442 I139F possibly damaging Het
Nrcam T C 12: 44,547,237 S262P probably benign Het
Nrp1 A G 8: 128,502,566 N842D probably benign Het
Olfml3 A G 3: 103,732,181 probably benign Het
Olfr1375 A G 11: 51,048,988 R294G probably damaging Het
Olfr1505 A T 19: 13,919,241 T74S probably benign Het
Olfr32 T A 2: 90,138,999 N47Y possibly damaging Het
Olfr421-ps1 T C 1: 174,151,596 Y27H possibly damaging Het
Olfr711 T A 7: 106,971,861 Y161F probably benign Het
Olfr773 G A 10: 129,186,645 P259S probably damaging Het
Olfr918 A G 9: 38,673,363 L27P probably damaging Het
Pde2a A G 7: 101,502,834 N316S probably benign Het
Pde4dip T A 3: 97,843,677 R74* probably null Het
Pex13 A T 11: 23,655,472 W253R possibly damaging Het
Piezo1 A T 8: 122,488,539 W1444R probably damaging Het
Pla2g4e T C 2: 120,167,933 K843R possibly damaging Het
Plxna2 C T 1: 194,644,445 P229L probably damaging Het
Prelid3b G T 2: 174,466,799 T131K probably benign Het
Pros1 T C 16: 62,889,007 probably null Het
Prrc2c G T 1: 162,697,687 P450Q unknown Het
Ptbp1 G T 10: 79,856,508 V5F possibly damaging Het
Ptk2 T A 15: 73,206,225 L997F probably damaging Het
Rims1 G T 1: 22,479,447 S525* probably null Het
Sh2b3 T A 5: 121,818,634 D318V probably benign Het
Slc16a13 A T 11: 70,220,275 I88N probably damaging Het
Slit2 T A 5: 48,257,003 probably null Het
Snx10 A G 6: 51,579,938 N67S probably damaging Het
Stil A G 4: 115,041,308 Y1045C probably damaging Het
Stra6 A G 9: 58,135,076 probably null Het
Sympk A G 7: 19,054,410 S1254G probably benign Het
Syt15 G T 14: 34,228,054 G377V probably damaging Het
Taar4 A T 10: 23,960,833 I114F probably damaging Het
Tcaf3 G A 6: 42,593,366 probably null Het
Tgm7 A T 2: 121,094,021 N558K probably benign Het
Tln2 T G 9: 67,397,653 M1L probably benign Het
Trim50 C T 5: 135,367,140 T314I probably damaging Het
Trp53rka A T 2: 165,491,392 Y192* probably null Het
Ube3b T C 5: 114,393,078 V211A probably benign Het
Ush2a A G 1: 188,399,941 S787G probably benign Het
Vmn1r189 T C 13: 22,102,119 M183V probably damaging Het
Vps13d G T 4: 145,178,212 Q115K probably benign Het
Zfp358 A G 8: 3,495,493 D25G probably damaging Het
Zfp521 T G 18: 13,844,590 K922T probably damaging Het
Zfp521 T A 18: 13,844,591 K922* probably null Het
Zfp68 T A 5: 138,616,481 K4* probably null Het
Other mutations in Epha7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00811:Epha7 APN 4 28961285 intron probably benign
IGL00849:Epha7 APN 4 28870662 missense possibly damaging 0.63
IGL00898:Epha7 APN 4 28938693 missense probably damaging 1.00
IGL02036:Epha7 APN 4 28950509 missense probably damaging 1.00
IGL02227:Epha7 APN 4 28821587 missense possibly damaging 0.85
IGL02237:Epha7 APN 4 28949325 splice site probably null
IGL02376:Epha7 APN 4 28951287 missense probably damaging 1.00
IGL02424:Epha7 APN 4 28948790 intron probably benign
IGL02519:Epha7 APN 4 28821494 missense possibly damaging 0.91
IGL02522:Epha7 APN 4 28821494 missense possibly damaging 0.91
IGL02524:Epha7 APN 4 28821494 missense possibly damaging 0.91
IGL02602:Epha7 APN 4 28871877 missense possibly damaging 0.88
PIT4514001:Epha7 UTSW 4 28961355 nonsense probably null
R0001:Epha7 UTSW 4 28961279 intron probably benign
R0011:Epha7 UTSW 4 28962564 missense probably benign 0.03
R0011:Epha7 UTSW 4 28962564 missense probably benign 0.03
R0310:Epha7 UTSW 4 28961301 missense probably benign 0.33
R0373:Epha7 UTSW 4 28935700 splice site probably null
R0496:Epha7 UTSW 4 28821292 missense probably damaging 1.00
R0554:Epha7 UTSW 4 28951401 missense probably damaging 1.00
R0632:Epha7 UTSW 4 28821104 missense probably damaging 1.00
R1677:Epha7 UTSW 4 28947571 nonsense probably null
R1883:Epha7 UTSW 4 28950362 missense possibly damaging 0.58
R1919:Epha7 UTSW 4 28963969 missense possibly damaging 0.48
R1952:Epha7 UTSW 4 28950474 missense probably damaging 0.97
R1999:Epha7 UTSW 4 28938686 nonsense probably null
R2187:Epha7 UTSW 4 28942648 missense possibly damaging 0.63
R2308:Epha7 UTSW 4 28821503 missense possibly damaging 0.91
R2417:Epha7 UTSW 4 28947579 missense probably damaging 1.00
R3911:Epha7 UTSW 4 28938680 missense probably benign 0.01
R4350:Epha7 UTSW 4 28950393 missense probably damaging 0.98
R4702:Epha7 UTSW 4 28961425 missense probably damaging 1.00
R4957:Epha7 UTSW 4 28871892 missense probably damaging 0.99
R5364:Epha7 UTSW 4 28950557 missense probably damaging 1.00
R5661:Epha7 UTSW 4 28946217 intron probably null
R5820:Epha7 UTSW 4 28949365 missense probably damaging 1.00
R6038:Epha7 UTSW 4 28821521 missense probably damaging 1.00
R6038:Epha7 UTSW 4 28821521 missense probably damaging 1.00
R6592:Epha7 UTSW 4 28813482 critical splice donor site probably null
R6783:Epha7 UTSW 4 28950528 missense possibly damaging 0.94
R6991:Epha7 UTSW 4 28821489 missense probably damaging 1.00
R7152:Epha7 UTSW 4 28935826 missense possibly damaging 0.94
R7232:Epha7 UTSW 4 28951279 missense probably damaging 1.00
R7261:Epha7 UTSW 4 28813418 missense probably benign 0.04
R7365:Epha7 UTSW 4 28871937 missense probably benign 0.07
R7367:Epha7 UTSW 4 28871937 missense probably benign 0.07
R7368:Epha7 UTSW 4 28871937 missense probably benign 0.07
R7413:Epha7 UTSW 4 28871838 missense probably benign 0.00
R7603:Epha7 UTSW 4 28871937 missense probably benign 0.07
R7604:Epha7 UTSW 4 28871937 missense probably benign 0.07
R7605:Epha7 UTSW 4 28871937 missense probably benign 0.07
R7607:Epha7 UTSW 4 28871937 missense probably benign 0.07
R7608:Epha7 UTSW 4 28871937 missense probably benign 0.07
R7609:Epha7 UTSW 4 28871937 missense probably benign 0.07
R7610:Epha7 UTSW 4 28871937 missense probably benign 0.07
R8073:Epha7 UTSW 4 28821022 missense probably damaging 1.00
R8263:Epha7 UTSW 4 28821149 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGGGAACTTGCAAGGAAAC -3'
(R):5'- GCACTGCAATGCATTCTGGG -3'

Sequencing Primer
(F):5'- GAACTTGCAAGGAAACGTTTAATTTG -3'
(R):5'- TCGGCACTGCTGACACATG -3'
Posted On2015-10-21