Incidental Mutation 'R4688:Vps13d'
ID353841
Institutional Source Beutler Lab
Gene Symbol Vps13d
Ensembl Gene ENSMUSG00000020220
Gene Namevacuolar protein sorting 13D
Synonyms
MMRRC Submission 041939-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4688 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location144972622-145195005 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 145178212 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 115 (Q115K)
Ref Sequence ENSEMBL: ENSMUSP00000043240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020441] [ENSMUST00000036579]
Predicted Effect probably benign
Transcript: ENSMUST00000020441
AA Change: Q115K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020441
Gene: ENSMUSG00000020220
AA Change: Q115K

DomainStartEndE-ValueType
Pfam:Chorein_N 2 118 1.8e-37 PFAM
low complexity region 407 423 N/A INTRINSIC
low complexity region 534 555 N/A INTRINSIC
coiled coil region 665 685 N/A INTRINSIC
low complexity region 765 781 N/A INTRINSIC
low complexity region 1316 1329 N/A INTRINSIC
low complexity region 1590 1603 N/A INTRINSIC
Blast:IL1 1605 1726 2e-6 BLAST
low complexity region 1868 1883 N/A INTRINSIC
low complexity region 2128 2141 N/A INTRINSIC
UBA 2632 2669 3.73e-5 SMART
low complexity region 2674 2684 N/A INTRINSIC
low complexity region 2707 2718 N/A INTRINSIC
low complexity region 2866 2884 N/A INTRINSIC
low complexity region 2973 2983 N/A INTRINSIC
Pfam:DUF1162 3246 3530 1.1e-110 PFAM
low complexity region 3797 3810 N/A INTRINSIC
low complexity region 3913 3921 N/A INTRINSIC
low complexity region 4119 4132 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000036579
AA Change: Q115K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000043240
Gene: ENSMUSG00000020220
AA Change: Q115K

DomainStartEndE-ValueType
Pfam:Chorein_N 2 116 3.5e-35 PFAM
Pfam:VPS13 131 353 9.6e-57 PFAM
low complexity region 407 423 N/A INTRINSIC
low complexity region 534 555 N/A INTRINSIC
Pfam:VPS13_mid_rpt 608 896 4.3e-35 PFAM
low complexity region 1316 1329 N/A INTRINSIC
low complexity region 1590 1603 N/A INTRINSIC
Blast:IL1 1605 1726 2e-6 BLAST
low complexity region 1868 1883 N/A INTRINSIC
low complexity region 2128 2141 N/A INTRINSIC
UBA 2632 2669 3.73e-5 SMART
low complexity region 2674 2684 N/A INTRINSIC
low complexity region 2707 2718 N/A INTRINSIC
low complexity region 2891 2909 N/A INTRINSIC
low complexity region 2998 3008 N/A INTRINSIC
Pfam:SHR-BD 3271 3555 4.2e-86 PFAM
low complexity region 3822 3835 N/A INTRINSIC
low complexity region 3938 3946 N/A INTRINSIC
Pfam:VPS13_C 3978 4126 4.8e-24 PFAM
low complexity region 4144 4157 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132700
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the vacuolar-protein-sorting-13 gene family. In yeast, vacuolar-protein-sorting-13 proteins are involved in trafficking of membrane proteins between the trans-Golgi network and the prevacuolar compartment. While several transcript variants may exist for this gene, the full-length natures of only two have been described to date. These two represent the major variants of this gene and encode distinct isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,593,449 S530P probably benign Het
1700003E16Rik A G 6: 83,162,698 N535S probably damaging Het
2810403A07Rik T A 3: 88,686,517 M71K probably damaging Het
9930021J03Rik A G 19: 29,717,101 I1664T probably benign Het
Abcc12 T C 8: 86,548,694 S452G possibly damaging Het
Acacb C A 5: 114,204,763 Q897K probably benign Het
Acot3 C A 12: 84,053,917 R145S probably damaging Het
AI314180 A G 4: 58,840,757 V667A probably damaging Het
Ankrd54 A T 15: 79,054,582 Y247N probably damaging Het
Arl11 G A 14: 61,311,097 V119I probably benign Het
Atxn7 T A 14: 14,089,288 M268K probably benign Het
Bms1 G A 6: 118,392,706 R934C probably damaging Het
Ccdc129 G A 6: 55,967,147 probably null Het
Chrnb3 T C 8: 27,394,119 S295P probably damaging Het
Cic TCCCCC TCCCCCCC 7: 25,291,670 probably null Het
Cnr1 A T 4: 33,944,571 I320F probably benign Het
Cntn4 C T 6: 106,437,949 P147L probably damaging Het
Col24a1 G A 3: 145,314,383 V172I probably benign Het
Col9a3 A G 2: 180,607,631 D262G probably damaging Het
Csrnp2 A G 15: 100,482,360 V350A probably damaging Het
D630045J12Rik A G 6: 38,196,657 V192A possibly damaging Het
Deptor A G 15: 55,208,781 M219V probably benign Het
Dmrtb1 A T 4: 107,684,050 L38Q probably damaging Het
Dvl2 G A 11: 70,007,518 R367Q possibly damaging Het
Dync1h1 T G 12: 110,655,528 I3435S probably damaging Het
Eif2b3 A G 4: 117,058,849 N218D probably benign Het
Epha2 A G 4: 141,318,981 D497G probably benign Het
Epha7 G T 4: 28,821,367 L177F probably damaging Het
Fam214b A G 4: 43,034,663 F352S probably damaging Het
Fam98c C T 7: 29,155,241 E147K probably damaging Het
Fbxo17 A G 7: 28,732,554 T19A probably benign Het
Fbxo47 A G 11: 97,856,223 F339S probably damaging Het
Frmd4a G T 2: 4,537,311 V234L possibly damaging Het
Gal3st2 A G 1: 93,872,523 D32G probably damaging Het
Gpr135 T C 12: 72,070,946 T16A probably benign Het
Gpr160 A T 3: 30,896,686 R302S probably benign Het
Hrh2 C A 13: 54,214,801 N265K probably benign Het
Htatip2 C A 7: 49,773,423 A242E probably damaging Het
Igfbp7 T C 5: 77,407,635 Y127C probably damaging Het
Igkv16-104 A G 6: 68,425,894 Q57R possibly damaging Het
Ino80c A G 18: 24,108,846 S161P probably damaging Het
Kcnc1 A G 7: 46,397,835 D53G probably benign Het
Lce1h G T 3: 92,763,567 R93S unknown Het
Lce1k T C 3: 92,806,644 S78G unknown Het
Lhcgr T A 17: 88,765,152 I156F probably damaging Het
Lpl T C 8: 68,899,425 Y343H probably damaging Het
Lrp6 G T 6: 134,479,743 R853S probably damaging Het
Lrrc7 A G 3: 158,148,605 V1322A probably damaging Het
Lrrc74a C T 12: 86,737,698 Q67* probably null Het
Megf6 A T 4: 154,253,814 D447V probably damaging Het
Mep1a T C 17: 43,482,248 D355G possibly damaging Het
Ncoa1 T C 12: 4,315,781 D95G probably benign Het
Npepl1 A T 2: 174,114,442 I139F possibly damaging Het
Nrcam T C 12: 44,547,237 S262P probably benign Het
Nrp1 A G 8: 128,502,566 N842D probably benign Het
Olfml3 A G 3: 103,732,181 probably benign Het
Olfr1375 A G 11: 51,048,988 R294G probably damaging Het
Olfr1505 A T 19: 13,919,241 T74S probably benign Het
Olfr32 T A 2: 90,138,999 N47Y possibly damaging Het
Olfr421-ps1 T C 1: 174,151,596 Y27H possibly damaging Het
Olfr711 T A 7: 106,971,861 Y161F probably benign Het
Olfr773 G A 10: 129,186,645 P259S probably damaging Het
Olfr918 A G 9: 38,673,363 L27P probably damaging Het
Pde2a A G 7: 101,502,834 N316S probably benign Het
Pde4dip T A 3: 97,843,677 R74* probably null Het
Pex13 A T 11: 23,655,472 W253R possibly damaging Het
Piezo1 A T 8: 122,488,539 W1444R probably damaging Het
Pla2g4e T C 2: 120,167,933 K843R possibly damaging Het
Plxna2 C T 1: 194,644,445 P229L probably damaging Het
Prelid3b G T 2: 174,466,799 T131K probably benign Het
Pros1 T C 16: 62,889,007 probably null Het
Prrc2c G T 1: 162,697,687 P450Q unknown Het
Ptbp1 G T 10: 79,856,508 V5F possibly damaging Het
Ptk2 T A 15: 73,206,225 L997F probably damaging Het
Rims1 G T 1: 22,479,447 S525* probably null Het
Sh2b3 T A 5: 121,818,634 D318V probably benign Het
Slc16a13 A T 11: 70,220,275 I88N probably damaging Het
Slit2 T A 5: 48,257,003 probably null Het
Snx10 A G 6: 51,579,938 N67S probably damaging Het
Stil A G 4: 115,041,308 Y1045C probably damaging Het
Stra6 A G 9: 58,135,076 probably null Het
Sympk A G 7: 19,054,410 S1254G probably benign Het
Syt15 G T 14: 34,228,054 G377V probably damaging Het
Taar4 A T 10: 23,960,833 I114F probably damaging Het
Tcaf3 G A 6: 42,593,366 probably null Het
Tgm7 A T 2: 121,094,021 N558K probably benign Het
Tln2 T G 9: 67,397,653 M1L probably benign Het
Trim50 C T 5: 135,367,140 T314I probably damaging Het
Trp53rka A T 2: 165,491,392 Y192* probably null Het
Ube3b T C 5: 114,393,078 V211A probably benign Het
Ush2a A G 1: 188,399,941 S787G probably benign Het
Vmn1r189 T C 13: 22,102,119 M183V probably damaging Het
Zfp358 A G 8: 3,495,493 D25G probably damaging Het
Zfp521 T G 18: 13,844,590 K922T probably damaging Het
Zfp521 T A 18: 13,844,591 K922* probably null Het
Zfp68 T A 5: 138,616,481 K4* probably null Het
Other mutations in Vps13d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Vps13d APN 4 145168540 missense probably damaging 0.98
IGL00484:Vps13d APN 4 145126575 missense probably benign 0.04
IGL00591:Vps13d APN 4 145190559 missense possibly damaging 0.95
IGL00816:Vps13d APN 4 145155994 missense probably benign 0.00
IGL00835:Vps13d APN 4 145160652 missense probably damaging 0.97
IGL00847:Vps13d APN 4 145085408 missense probably benign 0.26
IGL01084:Vps13d APN 4 145154955 missense probably benign 0.00
IGL01116:Vps13d APN 4 144972750 unclassified probably benign
IGL01150:Vps13d APN 4 145149275 missense probably benign
IGL01329:Vps13d APN 4 145156206 missense possibly damaging 0.69
IGL01338:Vps13d APN 4 145088322 missense probably damaging 1.00
IGL01583:Vps13d APN 4 145045088 missense probably damaging 1.00
IGL01598:Vps13d APN 4 145016901 missense probably benign 0.21
IGL01620:Vps13d APN 4 145094867 missense possibly damaging 0.70
IGL01636:Vps13d APN 4 145075048 missense probably damaging 1.00
IGL01723:Vps13d APN 4 145173145 missense possibly damaging 0.84
IGL01895:Vps13d APN 4 145156266 missense possibly damaging 0.57
IGL01981:Vps13d APN 4 145086747 missense probably damaging 0.99
IGL02192:Vps13d APN 4 145148858 missense probably benign 0.02
IGL02197:Vps13d APN 4 145128309 missense probably benign 0.01
IGL02209:Vps13d APN 4 145156101 missense probably damaging 0.97
IGL02219:Vps13d APN 4 145168146 missense probably benign 0.00
IGL02377:Vps13d APN 4 145156364 missense probably damaging 1.00
IGL02404:Vps13d APN 4 145148735 missense probably damaging 1.00
IGL02552:Vps13d APN 4 145173137 missense possibly damaging 0.46
IGL02651:Vps13d APN 4 145164559 missense probably benign 0.02
IGL02708:Vps13d APN 4 145128280 missense probably benign 0.12
IGL02811:Vps13d APN 4 145131765 missense possibly damaging 0.55
IGL02821:Vps13d APN 4 145148762 missense probably damaging 0.98
IGL02838:Vps13d APN 4 145075025 missense probably benign 0.31
IGL02968:Vps13d APN 4 145122498 missense probably benign 0.32
IGL03176:Vps13d APN 4 145074963 missense probably benign 0.16
IGL03352:Vps13d APN 4 145167502 missense possibly damaging 0.49
IGL03374:Vps13d APN 4 145108575 missense possibly damaging 0.70
IGL03375:Vps13d APN 4 145091947 missense probably damaging 1.00
IGL03383:Vps13d APN 4 145168319 critical splice acceptor site probably null
IGL03411:Vps13d APN 4 145149324 missense probably damaging 1.00
PIT4283001:Vps13d UTSW 4 145108588 missense
PIT4434001:Vps13d UTSW 4 145155247 missense
R0069:Vps13d UTSW 4 145062563 missense probably benign 0.09
R0069:Vps13d UTSW 4 145062563 missense probably benign 0.09
R0076:Vps13d UTSW 4 145164694 splice site probably benign
R0211:Vps13d UTSW 4 145114778 missense probably benign 0.08
R0219:Vps13d UTSW 4 145105909 missense probably benign 0.01
R0284:Vps13d UTSW 4 145144802 missense probably benign 0.01
R0345:Vps13d UTSW 4 145117625 missense possibly damaging 0.81
R0400:Vps13d UTSW 4 145065827 missense probably benign 0.00
R0417:Vps13d UTSW 4 144976560 missense probably benign 0.19
R0538:Vps13d UTSW 4 145045095 missense probably damaging 1.00
R0560:Vps13d UTSW 4 145054190 missense probably damaging 1.00
R0627:Vps13d UTSW 4 145087184 missense probably damaging 1.00
R0707:Vps13d UTSW 4 145155932 missense probably damaging 1.00
R0782:Vps13d UTSW 4 145126625 splice site probably benign
R0925:Vps13d UTSW 4 145156551 missense probably damaging 1.00
R0993:Vps13d UTSW 4 145117692 nonsense probably null
R1135:Vps13d UTSW 4 145155589 missense probably benign 0.01
R1165:Vps13d UTSW 4 145126471 missense probably benign
R1263:Vps13d UTSW 4 145170348 missense probably benign 0.01
R1397:Vps13d UTSW 4 145141334 missense probably damaging 1.00
R1398:Vps13d UTSW 4 145099983 missense probably null
R1521:Vps13d UTSW 4 145105861 missense probably benign 0.00
R1522:Vps13d UTSW 4 145098172 splice site probably null
R1725:Vps13d UTSW 4 145143260 missense possibly damaging 0.90
R1759:Vps13d UTSW 4 145155857 missense probably benign
R1826:Vps13d UTSW 4 145155003 missense probably damaging 0.96
R1900:Vps13d UTSW 4 145126606 missense probably benign 0.23
R1943:Vps13d UTSW 4 145155857 missense probably benign
R1955:Vps13d UTSW 4 145156143 missense probably damaging 1.00
R2008:Vps13d UTSW 4 145155243 missense probably benign 0.00
R2013:Vps13d UTSW 4 145108508 missense probably damaging 0.99
R2014:Vps13d UTSW 4 145108508 missense probably damaging 0.99
R2038:Vps13d UTSW 4 145181115 critical splice donor site probably null
R2108:Vps13d UTSW 4 145075047 missense probably damaging 0.99
R2130:Vps13d UTSW 4 145156101 missense probably benign 0.17
R2134:Vps13d UTSW 4 145148339 missense probably benign 0.00
R2168:Vps13d UTSW 4 145087323 splice site probably benign
R2220:Vps13d UTSW 4 145178320 missense probably damaging 1.00
R2240:Vps13d UTSW 4 145110895 missense possibly damaging 0.70
R2332:Vps13d UTSW 4 145148686 missense probably benign
R2357:Vps13d UTSW 4 145074977 frame shift probably null
R2365:Vps13d UTSW 4 145087324 splice site probably benign
R2571:Vps13d UTSW 4 145149136 missense probably benign 0.20
R3149:Vps13d UTSW 4 145126577 missense possibly damaging 0.70
R3150:Vps13d UTSW 4 145086790 missense probably damaging 0.98
R3547:Vps13d UTSW 4 145074975 missense probably damaging 0.99
R3716:Vps13d UTSW 4 145075726 missense probably damaging 1.00
R3718:Vps13d UTSW 4 145075726 missense probably damaging 1.00
R3725:Vps13d UTSW 4 145115648 splice site probably benign
R3794:Vps13d UTSW 4 145085437 splice site probably benign
R3875:Vps13d UTSW 4 145190544 missense probably damaging 1.00
R3948:Vps13d UTSW 4 145141340 missense probably damaging 1.00
R3953:Vps13d UTSW 4 145148880 missense probably damaging 1.00
R4021:Vps13d UTSW 4 145075061 missense possibly damaging 0.90
R4323:Vps13d UTSW 4 145152778 missense probably benign 0.28
R4346:Vps13d UTSW 4 145072529 intron probably benign
R4509:Vps13d UTSW 4 145062602 missense probably damaging 1.00
R4613:Vps13d UTSW 4 145131655 missense possibly damaging 0.95
R4657:Vps13d UTSW 4 145074842 missense probably damaging 1.00
R4680:Vps13d UTSW 4 145108510 missense possibly damaging 0.94
R4797:Vps13d UTSW 4 145054155 missense probably damaging 1.00
R4798:Vps13d UTSW 4 145178056 missense probably damaging 0.98
R4817:Vps13d UTSW 4 145069165 missense probably damaging 1.00
R4839:Vps13d UTSW 4 145085430 missense possibly damaging 0.95
R4860:Vps13d UTSW 4 145087161 missense probably benign
R4860:Vps13d UTSW 4 145087161 missense probably benign
R4869:Vps13d UTSW 4 145128042 missense probably damaging 1.00
R4904:Vps13d UTSW 4 145155445 missense probably damaging 1.00
R4912:Vps13d UTSW 4 145155857 missense probably benign
R4916:Vps13d UTSW 4 144983393 missense probably damaging 1.00
R4976:Vps13d UTSW 4 145105898 missense possibly damaging 0.82
R5029:Vps13d UTSW 4 145156282 missense probably benign 0.02
R5049:Vps13d UTSW 4 145086766 missense probably damaging 1.00
R5077:Vps13d UTSW 4 145088241 missense probably damaging 0.98
R5119:Vps13d UTSW 4 145105898 missense possibly damaging 0.82
R5227:Vps13d UTSW 4 145181207 splice site probably null
R5291:Vps13d UTSW 4 145062569 missense probably damaging 0.99
R5344:Vps13d UTSW 4 145178334 missense probably damaging 0.98
R5348:Vps13d UTSW 4 145065889 missense probably damaging 0.99
R5478:Vps13d UTSW 4 145167550 missense probably damaging 0.99
R5632:Vps13d UTSW 4 145074882 missense probably damaging 0.99
R5642:Vps13d UTSW 4 145170302 missense possibly damaging 0.66
R5712:Vps13d UTSW 4 145087173 missense probably benign 0.07
R5747:Vps13d UTSW 4 145168283 missense probably benign 0.00
R5752:Vps13d UTSW 4 145148970 missense probably benign 0.06
R5804:Vps13d UTSW 4 145100070 missense probably benign 0.03
R5917:Vps13d UTSW 4 145100010 missense probably damaging 0.96
R5932:Vps13d UTSW 4 145045041 missense possibly damaging 0.71
R5940:Vps13d UTSW 4 145074975 missense probably benign 0.09
R5978:Vps13d UTSW 4 145122611 missense probably benign
R6031:Vps13d UTSW 4 145168509 missense probably benign 0.01
R6031:Vps13d UTSW 4 145168509 missense probably benign 0.01
R6143:Vps13d UTSW 4 145148565 missense possibly damaging 0.95
R6174:Vps13d UTSW 4 144975193 nonsense probably null
R6191:Vps13d UTSW 4 145149348 missense probably damaging 1.00
R6198:Vps13d UTSW 4 145148990 missense probably benign 0.28
R6374:Vps13d UTSW 4 145122681 missense probably damaging 1.00
R6379:Vps13d UTSW 4 145088258 missense probably benign
R6388:Vps13d UTSW 4 145155574 missense probably benign 0.06
R6418:Vps13d UTSW 4 145092280 missense probably damaging 0.98
R6466:Vps13d UTSW 4 145057495 missense possibly damaging 0.47
R6602:Vps13d UTSW 4 145103664 intron probably benign
R6604:Vps13d UTSW 4 145181124 missense probably damaging 1.00
R7051:Vps13d UTSW 4 145163344 missense probably benign 0.00
R7052:Vps13d UTSW 4 145163344 missense probably benign 0.00
R7103:Vps13d UTSW 4 145115492 missense
R7231:Vps13d UTSW 4 145057462 missense
R7246:Vps13d UTSW 4 145156050 missense
R7339:Vps13d UTSW 4 145121368 missense
R7409:Vps13d UTSW 4 145141254 missense
R7419:Vps13d UTSW 4 145115503 missense
R7424:Vps13d UTSW 4 145148747 missense
R7439:Vps13d UTSW 4 145105856 missense
R7440:Vps13d UTSW 4 145128411 missense
R7528:Vps13d UTSW 4 145091922 missense
R7547:Vps13d UTSW 4 145057538 missense
R7558:Vps13d UTSW 4 145154580 missense
R7729:Vps13d UTSW 4 145075052 missense
R7789:Vps13d UTSW 4 145100065 missense
R7813:Vps13d UTSW 4 145178063 nonsense probably null
R7834:Vps13d UTSW 4 145108573 missense
R7840:Vps13d UTSW 4 145103676 missense
R7880:Vps13d UTSW 4 145181114 critical splice donor site probably null
R7912:Vps13d UTSW 4 145173127 missense
R7917:Vps13d UTSW 4 145108573 missense
R7923:Vps13d UTSW 4 145103676 missense
R7963:Vps13d UTSW 4 145181114 critical splice donor site probably null
R7993:Vps13d UTSW 4 145173127 missense
R8021:Vps13d UTSW 4 145148675 missense
R8048:Vps13d UTSW 4 145155567 missense
R8057:Vps13d UTSW 4 144975183 missense
R8063:Vps13d UTSW 4 145114757 missense
X0021:Vps13d UTSW 4 145155025 missense probably damaging 0.99
Z1176:Vps13d UTSW 4 145107067 missense
Z1177:Vps13d UTSW 4 145154908 missense
Z1177:Vps13d UTSW 4 145178296 missense
Predicted Primers PCR Primer
(F):5'- GATTCTCGTGACAACTGATGC -3'
(R):5'- GCTGAGAAATGTGCAGGTGTC -3'

Sequencing Primer
(F):5'- CTCGTGACAACTGATGCAGTGAC -3'
(R):5'- GATGAGAGGATCCTTCTCCTTCCAG -3'
Posted On2015-10-21