Incidental Mutation 'R4688:Acacb'
ID353844
Institutional Source Beutler Lab
Gene Symbol Acacb
Ensembl Gene ENSMUSG00000042010
Gene Nameacetyl-Coenzyme A carboxylase beta
SynonymsAcc2, Accb
MMRRC Submission 041939-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4688 (G1)
Quality Score213
Status Not validated
Chromosome5
Chromosomal Location114146535-114250761 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 114204763 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 897 (Q897K)
Ref Sequence ENSEMBL: ENSMUSP00000099642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031583] [ENSMUST00000102582]
Predicted Effect probably benign
Transcript: ENSMUST00000031583
AA Change: Q897K

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000031583
Gene: ENSMUSG00000042010
AA Change: Q897K

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 38 60 N/A INTRINSIC
Pfam:CPSase_L_chain 249 369 2.1e-32 PFAM
Pfam:CPSase_L_D2 405 606 3.3e-52 PFAM
Pfam:ATP-grasp_4 413 576 2.1e-9 PFAM
Biotin_carb_C 640 747 9.54e-26 SMART
Pfam:Biotin_lipoyl 885 951 1.9e-17 PFAM
Pfam:ACC_central 952 1678 2.2e-290 PFAM
Pfam:Carboxyl_trans 1770 2324 2.3e-181 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102582
AA Change: Q897K

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000099642
Gene: ENSMUSG00000042010
AA Change: Q897K

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 38 60 N/A INTRINSIC
Pfam:CPSase_L_chain 249 369 8.2e-29 PFAM
Pfam:CPSase_L_D2 405 606 3.8e-52 PFAM
Pfam:ATP-grasp_4 409 576 1.4e-12 PFAM
Biotin_carb_C 640 747 9.54e-26 SMART
Pfam:Biotin_lipoyl 885 951 9.1e-17 PFAM
Pfam:ACC_central 952 1678 2.3e-250 PFAM
Pfam:Carboxyl_trans 1770 2324 4.8e-172 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143276
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. ACC-beta is thought to control fatty acid oxidation by means of the ability of malonyl-CoA to inhibit carnitine-palmitoyl-CoA transferase I, the rate-limiting step in fatty acid uptake and oxidation by mitochondria. ACC-beta may be involved in the regulation of fatty acid oxidation, rather than fatty acid biosynthesis. There is evidence for the presence of two ACC-beta isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile and overtly normal but exhibit high levels of fatty acid oxidation, as well as reduced fat accumulation in their adipose tissue and liver, and decreased storage of glycogen in their liver. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,593,449 S530P probably benign Het
1700003E16Rik A G 6: 83,162,698 N535S probably damaging Het
2810403A07Rik T A 3: 88,686,517 M71K probably damaging Het
9930021J03Rik A G 19: 29,717,101 I1664T probably benign Het
Abcc12 T C 8: 86,548,694 S452G possibly damaging Het
Acot3 C A 12: 84,053,917 R145S probably damaging Het
AI314180 A G 4: 58,840,757 V667A probably damaging Het
Ankrd54 A T 15: 79,054,582 Y247N probably damaging Het
Arl11 G A 14: 61,311,097 V119I probably benign Het
Atxn7 T A 14: 14,089,288 M268K probably benign Het
Bms1 G A 6: 118,392,706 R934C probably damaging Het
Ccdc129 G A 6: 55,967,147 probably null Het
Chrnb3 T C 8: 27,394,119 S295P probably damaging Het
Cic TCCCCC TCCCCCCC 7: 25,291,670 probably null Het
Cnr1 A T 4: 33,944,571 I320F probably benign Het
Cntn4 C T 6: 106,437,949 P147L probably damaging Het
Col24a1 G A 3: 145,314,383 V172I probably benign Het
Col9a3 A G 2: 180,607,631 D262G probably damaging Het
Csrnp2 A G 15: 100,482,360 V350A probably damaging Het
D630045J12Rik A G 6: 38,196,657 V192A possibly damaging Het
Deptor A G 15: 55,208,781 M219V probably benign Het
Dmrtb1 A T 4: 107,684,050 L38Q probably damaging Het
Dvl2 G A 11: 70,007,518 R367Q possibly damaging Het
Dync1h1 T G 12: 110,655,528 I3435S probably damaging Het
Eif2b3 A G 4: 117,058,849 N218D probably benign Het
Epha2 A G 4: 141,318,981 D497G probably benign Het
Epha7 G T 4: 28,821,367 L177F probably damaging Het
Fam214b A G 4: 43,034,663 F352S probably damaging Het
Fam98c C T 7: 29,155,241 E147K probably damaging Het
Fbxo17 A G 7: 28,732,554 T19A probably benign Het
Fbxo47 A G 11: 97,856,223 F339S probably damaging Het
Frmd4a G T 2: 4,537,311 V234L possibly damaging Het
Gal3st2 A G 1: 93,872,523 D32G probably damaging Het
Gpr135 T C 12: 72,070,946 T16A probably benign Het
Gpr160 A T 3: 30,896,686 R302S probably benign Het
Hrh2 C A 13: 54,214,801 N265K probably benign Het
Htatip2 C A 7: 49,773,423 A242E probably damaging Het
Igfbp7 T C 5: 77,407,635 Y127C probably damaging Het
Igkv16-104 A G 6: 68,425,894 Q57R possibly damaging Het
Ino80c A G 18: 24,108,846 S161P probably damaging Het
Kcnc1 A G 7: 46,397,835 D53G probably benign Het
Lce1h G T 3: 92,763,567 R93S unknown Het
Lce1k T C 3: 92,806,644 S78G unknown Het
Lhcgr T A 17: 88,765,152 I156F probably damaging Het
Lpl T C 8: 68,899,425 Y343H probably damaging Het
Lrp6 G T 6: 134,479,743 R853S probably damaging Het
Lrrc7 A G 3: 158,148,605 V1322A probably damaging Het
Lrrc74a C T 12: 86,737,698 Q67* probably null Het
Megf6 A T 4: 154,253,814 D447V probably damaging Het
Mep1a T C 17: 43,482,248 D355G possibly damaging Het
Ncoa1 T C 12: 4,315,781 D95G probably benign Het
Npepl1 A T 2: 174,114,442 I139F possibly damaging Het
Nrcam T C 12: 44,547,237 S262P probably benign Het
Nrp1 A G 8: 128,502,566 N842D probably benign Het
Olfml3 A G 3: 103,732,181 probably benign Het
Olfr1375 A G 11: 51,048,988 R294G probably damaging Het
Olfr1505 A T 19: 13,919,241 T74S probably benign Het
Olfr32 T A 2: 90,138,999 N47Y possibly damaging Het
Olfr421-ps1 T C 1: 174,151,596 Y27H possibly damaging Het
Olfr711 T A 7: 106,971,861 Y161F probably benign Het
Olfr773 G A 10: 129,186,645 P259S probably damaging Het
Olfr918 A G 9: 38,673,363 L27P probably damaging Het
Pde2a A G 7: 101,502,834 N316S probably benign Het
Pde4dip T A 3: 97,843,677 R74* probably null Het
Pex13 A T 11: 23,655,472 W253R possibly damaging Het
Piezo1 A T 8: 122,488,539 W1444R probably damaging Het
Pla2g4e T C 2: 120,167,933 K843R possibly damaging Het
Plxna2 C T 1: 194,644,445 P229L probably damaging Het
Prelid3b G T 2: 174,466,799 T131K probably benign Het
Pros1 T C 16: 62,889,007 probably null Het
Prrc2c G T 1: 162,697,687 P450Q unknown Het
Ptbp1 G T 10: 79,856,508 V5F possibly damaging Het
Ptk2 T A 15: 73,206,225 L997F probably damaging Het
Rims1 G T 1: 22,479,447 S525* probably null Het
Sh2b3 T A 5: 121,818,634 D318V probably benign Het
Slc16a13 A T 11: 70,220,275 I88N probably damaging Het
Slit2 T A 5: 48,257,003 probably null Het
Snx10 A G 6: 51,579,938 N67S probably damaging Het
Stil A G 4: 115,041,308 Y1045C probably damaging Het
Stra6 A G 9: 58,135,076 probably null Het
Sympk A G 7: 19,054,410 S1254G probably benign Het
Syt15 G T 14: 34,228,054 G377V probably damaging Het
Taar4 A T 10: 23,960,833 I114F probably damaging Het
Tcaf3 G A 6: 42,593,366 probably null Het
Tgm7 A T 2: 121,094,021 N558K probably benign Het
Tln2 T G 9: 67,397,653 M1L probably benign Het
Trim50 C T 5: 135,367,140 T314I probably damaging Het
Trp53rka A T 2: 165,491,392 Y192* probably null Het
Ube3b T C 5: 114,393,078 V211A probably benign Het
Ush2a A G 1: 188,399,941 S787G probably benign Het
Vmn1r189 T C 13: 22,102,119 M183V probably damaging Het
Vps13d G T 4: 145,178,212 Q115K probably benign Het
Zfp358 A G 8: 3,495,493 D25G probably damaging Het
Zfp521 T G 18: 13,844,590 K922T probably damaging Het
Zfp521 T A 18: 13,844,591 K922* probably null Het
Zfp68 T A 5: 138,616,481 K4* probably null Het
Other mutations in Acacb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Acacb APN 5 114200289 missense probably damaging 1.00
IGL01291:Acacb APN 5 114225870 missense probably benign 0.03
IGL01301:Acacb APN 5 114246498 missense probably benign
IGL01633:Acacb APN 5 114218858 splice site probably benign
IGL01736:Acacb APN 5 114188442 missense possibly damaging 0.96
IGL01782:Acacb APN 5 114200520 missense probably damaging 1.00
IGL01924:Acacb APN 5 114223986 splice site probably benign
IGL01933:Acacb APN 5 114184190 splice site probably benign
IGL02028:Acacb APN 5 114166015 missense probably damaging 1.00
IGL02045:Acacb APN 5 114240660 missense possibly damaging 0.95
IGL02346:Acacb APN 5 114238699 missense probably damaging 1.00
IGL02421:Acacb APN 5 114223878 missense probably benign 0.00
IGL02445:Acacb APN 5 114245137 missense probably damaging 1.00
IGL02491:Acacb APN 5 114192105 missense probably damaging 1.00
IGL02598:Acacb APN 5 114246037 missense probably damaging 1.00
IGL02700:Acacb APN 5 114218881 missense probably damaging 1.00
IGL02730:Acacb APN 5 114166149 splice site probably benign
IGL03110:Acacb APN 5 114195234 missense probably damaging 0.96
IGL03125:Acacb APN 5 114204805 missense possibly damaging 0.49
IGL03263:Acacb APN 5 114213693 missense probably damaging 1.00
IGL03324:Acacb APN 5 114225854 nonsense probably null
ANU05:Acacb UTSW 5 114225870 missense probably benign 0.03
ANU18:Acacb UTSW 5 114246498 missense probably benign
BB001:Acacb UTSW 5 114245220 missense not run
BB011:Acacb UTSW 5 114245220 missense not run
I0000:Acacb UTSW 5 114238655 missense probably damaging 0.99
R0001:Acacb UTSW 5 114204833 splice site probably benign
R0219:Acacb UTSW 5 114232944 missense possibly damaging 0.79
R0234:Acacb UTSW 5 114209817 missense probably damaging 0.99
R0234:Acacb UTSW 5 114209817 missense probably damaging 0.99
R0278:Acacb UTSW 5 114233259 nonsense probably null
R0607:Acacb UTSW 5 114200301 missense probably damaging 1.00
R0964:Acacb UTSW 5 114229752 missense possibly damaging 0.64
R1116:Acacb UTSW 5 114210956 missense probably damaging 1.00
R1196:Acacb UTSW 5 114245092 missense probably benign 0.00
R1204:Acacb UTSW 5 114190153 missense probably damaging 1.00
R1387:Acacb UTSW 5 114200512 missense probably benign
R1415:Acacb UTSW 5 114165921 missense probably benign
R1475:Acacb UTSW 5 114195252 missense possibly damaging 0.87
R1497:Acacb UTSW 5 114196807 missense probably damaging 1.00
R1520:Acacb UTSW 5 114201940 missense possibly damaging 0.67
R1591:Acacb UTSW 5 114203423 missense possibly damaging 0.87
R1644:Acacb UTSW 5 114195285 missense probably damaging 1.00
R1732:Acacb UTSW 5 114190087 missense possibly damaging 0.63
R1783:Acacb UTSW 5 114209767 frame shift probably null
R1784:Acacb UTSW 5 114209767 frame shift probably null
R1834:Acacb UTSW 5 114235475 missense probably damaging 1.00
R1858:Acacb UTSW 5 114196709 missense probably benign 0.13
R1886:Acacb UTSW 5 114218959 missense probably damaging 1.00
R1901:Acacb UTSW 5 114165734 nonsense probably null
R1902:Acacb UTSW 5 114165734 nonsense probably null
R1903:Acacb UTSW 5 114165734 nonsense probably null
R1924:Acacb UTSW 5 114230720 missense possibly damaging 0.67
R1934:Acacb UTSW 5 114198282 missense probably benign 0.27
R2051:Acacb UTSW 5 114245890 missense probably damaging 1.00
R2132:Acacb UTSW 5 114209767 frame shift probably null
R2133:Acacb UTSW 5 114209767 frame shift probably null
R2260:Acacb UTSW 5 114216917 missense probably damaging 0.99
R2967:Acacb UTSW 5 114166070 missense possibly damaging 0.81
R3421:Acacb UTSW 5 114212636 splice site probably null
R3729:Acacb UTSW 5 114207348 missense probably damaging 0.99
R4206:Acacb UTSW 5 114213651 missense probably benign
R4245:Acacb UTSW 5 114230784 missense probably damaging 0.97
R4386:Acacb UTSW 5 114241921 critical splice acceptor site probably null
R4439:Acacb UTSW 5 114246496 missense possibly damaging 0.50
R4577:Acacb UTSW 5 114226831 missense probably damaging 1.00
R4658:Acacb UTSW 5 114200564 missense probably damaging 0.96
R4720:Acacb UTSW 5 114229914 missense possibly damaging 0.73
R4898:Acacb UTSW 5 114232938 missense probably benign 0.04
R5044:Acacb UTSW 5 114166027 missense probably benign 0.03
R5070:Acacb UTSW 5 114246028 missense possibly damaging 0.46
R5294:Acacb UTSW 5 114241952 missense probably damaging 1.00
R5350:Acacb UTSW 5 114244551 missense probably damaging 1.00
R5401:Acacb UTSW 5 114209853 missense possibly damaging 0.80
R5531:Acacb UTSW 5 114204706 missense possibly damaging 0.92
R5542:Acacb UTSW 5 114195737 missense probably damaging 1.00
R5751:Acacb UTSW 5 114230832 missense possibly damaging 0.79
R5821:Acacb UTSW 5 114184106 missense possibly damaging 0.69
R5893:Acacb UTSW 5 114229851 missense probably benign 0.01
R5911:Acacb UTSW 5 114232890 missense probably damaging 0.97
R5944:Acacb UTSW 5 114245980 missense probably damaging 1.00
R5973:Acacb UTSW 5 114226867 missense probably damaging 1.00
R6027:Acacb UTSW 5 114165600 missense probably benign 0.43
R6103:Acacb UTSW 5 114245881 missense probably damaging 1.00
R6139:Acacb UTSW 5 114212652 missense probably damaging 1.00
R6292:Acacb UTSW 5 114200251 missense probably damaging 1.00
R6368:Acacb UTSW 5 114216823 missense probably damaging 0.98
R6429:Acacb UTSW 5 114228591 missense probably damaging 1.00
R6942:Acacb UTSW 5 114191963 critical splice donor site probably null
R7138:Acacb UTSW 5 114207326 missense probably benign 0.12
R7241:Acacb UTSW 5 114245100 missense possibly damaging 0.94
R7254:Acacb UTSW 5 114209751 critical splice acceptor site probably null
R7396:Acacb UTSW 5 114213661 missense possibly damaging 0.87
R7439:Acacb UTSW 5 114195642 missense possibly damaging 0.84
R7484:Acacb UTSW 5 114218862 missense probably damaging 1.00
R7585:Acacb UTSW 5 114246012 missense probably damaging 0.99
R7712:Acacb UTSW 5 114165738 missense probably benign 0.13
R7868:Acacb UTSW 5 114248227 missense probably benign 0.22
R7873:Acacb UTSW 5 114223278 missense possibly damaging 0.88
R7951:Acacb UTSW 5 114248227 missense probably benign 0.22
R7956:Acacb UTSW 5 114223278 missense possibly damaging 0.88
R8007:Acacb UTSW 5 114218874 missense probably damaging 0.97
R8022:Acacb UTSW 5 114223854 missense probably benign
R8030:Acacb UTSW 5 114233167 missense probably damaging 1.00
R8241:Acacb UTSW 5 114195236 missense possibly damaging 0.49
R8264:Acacb UTSW 5 114207366 missense probably benign 0.00
R8292:Acacb UTSW 5 114200494 critical splice acceptor site probably null
V1662:Acacb UTSW 5 114238708 missense probably damaging 1.00
Z1176:Acacb UTSW 5 114248948 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AAAGGCCCTAATGTCTCACAG -3'
(R):5'- CACAAGGAATTGGGCTGAAC -3'

Sequencing Primer
(F):5'- AATGCCTGCCTTGGGAAG -3'
(R):5'- TGAACCCTGCATGCCGAAGAG -3'
Posted On2015-10-21